ID: 1076288916

View in Genome Browser
Species Human (GRCh38)
Location 10:129328988-129329010
Sequence AAAAATAGCCCACACTGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076288914_1076288916 -7 Left 1076288914 10:129328972-129328994 CCTGGCAGCTGGGAAAAAAAATA No data
Right 1076288916 10:129328988-129329010 AAAAATAGCCCACACTGCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076288916 Original CRISPR AAAAATAGCCCACACTGCGG AGG Intergenic
No off target data available for this crispr