ID: 1076291875

View in Genome Browser
Species Human (GRCh38)
Location 10:129351760-129351782
Sequence TGCTCCCACTGGAGGCTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076291875_1076291881 7 Left 1076291875 10:129351760-129351782 CCCCAAAGCCTCCAGTGGGAGCA No data
Right 1076291881 10:129351790-129351812 GCCAGCACCTTGAGACCTTCTGG No data
1076291875_1076291885 20 Left 1076291875 10:129351760-129351782 CCCCAAAGCCTCCAGTGGGAGCA No data
Right 1076291885 10:129351803-129351825 GACCTTCTGGCCTCCAGACTGGG No data
1076291875_1076291884 19 Left 1076291875 10:129351760-129351782 CCCCAAAGCCTCCAGTGGGAGCA No data
Right 1076291884 10:129351802-129351824 AGACCTTCTGGCCTCCAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076291875 Original CRISPR TGCTCCCACTGGAGGCTTTG GGG (reversed) Intergenic
No off target data available for this crispr