ID: 1076292437

View in Genome Browser
Species Human (GRCh38)
Location 10:129357090-129357112
Sequence CAAATCCTTAGACGTGGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076292432_1076292437 2 Left 1076292432 10:129357065-129357087 CCAGGGTGAGCCCAATCTAATAC No data
Right 1076292437 10:129357090-129357112 CAAATCCTTAGACGTGGAGCTGG No data
1076292434_1076292437 -9 Left 1076292434 10:129357076-129357098 CCAATCTAATACCACAAATCCTT No data
Right 1076292437 10:129357090-129357112 CAAATCCTTAGACGTGGAGCTGG No data
1076292433_1076292437 -8 Left 1076292433 10:129357075-129357097 CCCAATCTAATACCACAAATCCT No data
Right 1076292437 10:129357090-129357112 CAAATCCTTAGACGTGGAGCTGG No data
1076292431_1076292437 12 Left 1076292431 10:129357055-129357077 CCTGGATTATCCAGGGTGAGCCC No data
Right 1076292437 10:129357090-129357112 CAAATCCTTAGACGTGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076292437 Original CRISPR CAAATCCTTAGACGTGGAGC TGG Intergenic
No off target data available for this crispr