ID: 1076292585

View in Genome Browser
Species Human (GRCh38)
Location 10:129358875-129358897
Sequence TTTTGTAAGGTGAAGGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076292574_1076292585 23 Left 1076292574 10:129358829-129358851 CCACACCCAACTATTGGCAAATG No data
Right 1076292585 10:129358875-129358897 TTTTGTAAGGTGAAGGGGGAAGG No data
1076292575_1076292585 18 Left 1076292575 10:129358834-129358856 CCCAACTATTGGCAAATGTTTTT No data
Right 1076292585 10:129358875-129358897 TTTTGTAAGGTGAAGGGGGAAGG No data
1076292576_1076292585 17 Left 1076292576 10:129358835-129358857 CCAACTATTGGCAAATGTTTTTA No data
Right 1076292585 10:129358875-129358897 TTTTGTAAGGTGAAGGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076292585 Original CRISPR TTTTGTAAGGTGAAGGGGGA AGG Intergenic
No off target data available for this crispr