ID: 1076293111

View in Genome Browser
Species Human (GRCh38)
Location 10:129362727-129362749
Sequence CACCCTAGGCTGTTTCTCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076293111_1076293116 0 Left 1076293111 10:129362727-129362749 CCCGGGAGAAACAGCCTAGGGTG No data
Right 1076293116 10:129362750-129362772 GTCAACAAGGTACCAACTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076293111 Original CRISPR CACCCTAGGCTGTTTCTCCC GGG (reversed) Intergenic
No off target data available for this crispr