ID: 1076294513

View in Genome Browser
Species Human (GRCh38)
Location 10:129374210-129374232
Sequence CAGTGTGAACAGAAAGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076294513_1076294518 19 Left 1076294513 10:129374210-129374232 CCCTCTGCTTTCTGTTCACACTG No data
Right 1076294518 10:129374252-129374274 ATGTCACAGCATCCCGGATGAGG No data
1076294513_1076294517 13 Left 1076294513 10:129374210-129374232 CCCTCTGCTTTCTGTTCACACTG No data
Right 1076294517 10:129374246-129374268 GTCATAATGTCACAGCATCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076294513 Original CRISPR CAGTGTGAACAGAAAGCAGA GGG (reversed) Intergenic
No off target data available for this crispr