ID: 1076294545

View in Genome Browser
Species Human (GRCh38)
Location 10:129374408-129374430
Sequence CTTGACTACCCCACTCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076294545_1076294550 -8 Left 1076294545 10:129374408-129374430 CCATCCTGAGTGGGGTAGTCAAG No data
Right 1076294550 10:129374423-129374445 TAGTCAAGGACAAGGATGGCAGG No data
1076294545_1076294551 5 Left 1076294545 10:129374408-129374430 CCATCCTGAGTGGGGTAGTCAAG No data
Right 1076294551 10:129374436-129374458 GGATGGCAGGCCGCATTTCTAGG No data
1076294545_1076294554 19 Left 1076294545 10:129374408-129374430 CCATCCTGAGTGGGGTAGTCAAG No data
Right 1076294554 10:129374450-129374472 ATTTCTAGGGCCAGAAAGAGAGG No data
1076294545_1076294552 6 Left 1076294545 10:129374408-129374430 CCATCCTGAGTGGGGTAGTCAAG No data
Right 1076294552 10:129374437-129374459 GATGGCAGGCCGCATTTCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076294545 Original CRISPR CTTGACTACCCCACTCAGGA TGG (reversed) Intergenic
No off target data available for this crispr