ID: 1076297471

View in Genome Browser
Species Human (GRCh38)
Location 10:129397717-129397739
Sequence TGCAGGACATGCGACACAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076297471_1076297480 8 Left 1076297471 10:129397717-129397739 CCCACTGTGTCGCATGTCCTGCA No data
Right 1076297480 10:129397748-129397770 CCCCGGCCTCGTTCCTGGGCAGG No data
1076297471_1076297475 -9 Left 1076297471 10:129397717-129397739 CCCACTGTGTCGCATGTCCTGCA No data
Right 1076297475 10:129397731-129397753 TGTCCTGCACTGGGTCACCCCGG No data
1076297471_1076297478 4 Left 1076297471 10:129397717-129397739 CCCACTGTGTCGCATGTCCTGCA No data
Right 1076297478 10:129397744-129397766 GTCACCCCGGCCTCGTTCCTGGG No data
1076297471_1076297482 9 Left 1076297471 10:129397717-129397739 CCCACTGTGTCGCATGTCCTGCA No data
Right 1076297482 10:129397749-129397771 CCCGGCCTCGTTCCTGGGCAGGG No data
1076297471_1076297477 3 Left 1076297471 10:129397717-129397739 CCCACTGTGTCGCATGTCCTGCA No data
Right 1076297477 10:129397743-129397765 GGTCACCCCGGCCTCGTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076297471 Original CRISPR TGCAGGACATGCGACACAGT GGG (reversed) Intergenic
No off target data available for this crispr