ID: 1076298908

View in Genome Browser
Species Human (GRCh38)
Location 10:129409693-129409715
Sequence CCATAGATAGTATGCTGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076298908_1076298916 29 Left 1076298908 10:129409693-129409715 CCTTCCCAGCATACTATCTATGG No data
Right 1076298916 10:129409745-129409767 TTGCTCTGATGAAACTGCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076298908 Original CRISPR CCATAGATAGTATGCTGGGA AGG (reversed) Intergenic
No off target data available for this crispr