ID: 1076298916

View in Genome Browser
Species Human (GRCh38)
Location 10:129409745-129409767
Sequence TTGCTCTGATGAAACTGCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076298915_1076298916 -4 Left 1076298915 10:129409726-129409748 CCAGCAAATACTTTGAGAGTTGC No data
Right 1076298916 10:129409745-129409767 TTGCTCTGATGAAACTGCTTAGG No data
1076298912_1076298916 6 Left 1076298912 10:129409716-129409738 CCCAGAATTCCCAGCAAATACTT No data
Right 1076298916 10:129409745-129409767 TTGCTCTGATGAAACTGCTTAGG No data
1076298908_1076298916 29 Left 1076298908 10:129409693-129409715 CCTTCCCAGCATACTATCTATGG No data
Right 1076298916 10:129409745-129409767 TTGCTCTGATGAAACTGCTTAGG No data
1076298913_1076298916 5 Left 1076298913 10:129409717-129409739 CCAGAATTCCCAGCAAATACTTT No data
Right 1076298916 10:129409745-129409767 TTGCTCTGATGAAACTGCTTAGG No data
1076298911_1076298916 24 Left 1076298911 10:129409698-129409720 CCAGCATACTATCTATGGCCCAG No data
Right 1076298916 10:129409745-129409767 TTGCTCTGATGAAACTGCTTAGG No data
1076298914_1076298916 -3 Left 1076298914 10:129409725-129409747 CCCAGCAAATACTTTGAGAGTTG No data
Right 1076298916 10:129409745-129409767 TTGCTCTGATGAAACTGCTTAGG No data
1076298910_1076298916 25 Left 1076298910 10:129409697-129409719 CCCAGCATACTATCTATGGCCCA No data
Right 1076298916 10:129409745-129409767 TTGCTCTGATGAAACTGCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076298916 Original CRISPR TTGCTCTGATGAAACTGCTT AGG Intergenic
No off target data available for this crispr