ID: 1076298945

View in Genome Browser
Species Human (GRCh38)
Location 10:129409890-129409912
Sequence GGACCCCCAGGAAAAAAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076298938_1076298945 -5 Left 1076298938 10:129409872-129409894 CCTTTCCCTGTACCCAGGGGACC No data
Right 1076298945 10:129409890-129409912 GGACCCCCAGGAAAAAAAGAGGG No data
1076298928_1076298945 26 Left 1076298928 10:129409841-129409863 CCCATTCCTAAAGCTGGGGTTGG No data
Right 1076298945 10:129409890-129409912 GGACCCCCAGGAAAAAAAGAGGG No data
1076298939_1076298945 -10 Left 1076298939 10:129409877-129409899 CCCTGTACCCAGGGGACCCCCAG No data
Right 1076298945 10:129409890-129409912 GGACCCCCAGGAAAAAAAGAGGG No data
1076298933_1076298945 20 Left 1076298933 10:129409847-129409869 CCTAAAGCTGGGGTTGGATGGGG No data
Right 1076298945 10:129409890-129409912 GGACCCCCAGGAAAAAAAGAGGG No data
1076298930_1076298945 25 Left 1076298930 10:129409842-129409864 CCATTCCTAAAGCTGGGGTTGGA No data
Right 1076298945 10:129409890-129409912 GGACCCCCAGGAAAAAAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076298945 Original CRISPR GGACCCCCAGGAAAAAAAGA GGG Intergenic