ID: 1076299688

View in Genome Browser
Species Human (GRCh38)
Location 10:129415574-129415596
Sequence CTATCCTGCTTCCAGTGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076299688_1076299692 0 Left 1076299688 10:129415574-129415596 CCTGGTCACTGGAAGCAGGATAG No data
Right 1076299692 10:129415597-129415619 CCTGTCTCGGCTGTAAGGACTGG No data
1076299688_1076299693 15 Left 1076299688 10:129415574-129415596 CCTGGTCACTGGAAGCAGGATAG No data
Right 1076299693 10:129415612-129415634 AGGACTGGTCGTTAACTGTCAGG No data
1076299688_1076299694 21 Left 1076299688 10:129415574-129415596 CCTGGTCACTGGAAGCAGGATAG No data
Right 1076299694 10:129415618-129415640 GGTCGTTAACTGTCAGGCACTGG No data
1076299688_1076299690 -5 Left 1076299688 10:129415574-129415596 CCTGGTCACTGGAAGCAGGATAG No data
Right 1076299690 10:129415592-129415614 GATAGCCTGTCTCGGCTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076299688 Original CRISPR CTATCCTGCTTCCAGTGACC AGG (reversed) Intergenic
No off target data available for this crispr