ID: 1076302936

View in Genome Browser
Species Human (GRCh38)
Location 10:129441740-129441762
Sequence AGCTTCAAAGGCGGCCCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076302930_1076302936 0 Left 1076302930 10:129441717-129441739 CCCGTGCTGTGAGACTTGCTGCC No data
Right 1076302936 10:129441740-129441762 AGCTTCAAAGGCGGCCCCCAGGG No data
1076302927_1076302936 17 Left 1076302927 10:129441700-129441722 CCCTGCTCTGCTCTGTCCCCGTG No data
Right 1076302936 10:129441740-129441762 AGCTTCAAAGGCGGCCCCCAGGG No data
1076302926_1076302936 26 Left 1076302926 10:129441691-129441713 CCTGGGTCTCCCTGCTCTGCTCT No data
Right 1076302936 10:129441740-129441762 AGCTTCAAAGGCGGCCCCCAGGG No data
1076302929_1076302936 1 Left 1076302929 10:129441716-129441738 CCCCGTGCTGTGAGACTTGCTGC No data
Right 1076302936 10:129441740-129441762 AGCTTCAAAGGCGGCCCCCAGGG No data
1076302931_1076302936 -1 Left 1076302931 10:129441718-129441740 CCGTGCTGTGAGACTTGCTGCCA No data
Right 1076302936 10:129441740-129441762 AGCTTCAAAGGCGGCCCCCAGGG No data
1076302928_1076302936 16 Left 1076302928 10:129441701-129441723 CCTGCTCTGCTCTGTCCCCGTGC No data
Right 1076302936 10:129441740-129441762 AGCTTCAAAGGCGGCCCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076302936 Original CRISPR AGCTTCAAAGGCGGCCCCCA GGG Intergenic