ID: 1076305337

View in Genome Browser
Species Human (GRCh38)
Location 10:129462101-129462123
Sequence CTGGGTCACTAGAAGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076305337_1076305346 12 Left 1076305337 10:129462101-129462123 CCCACTTCCTTCTAGTGACCCAG No data
Right 1076305346 10:129462136-129462158 CAGCTCTTCACACCATTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076305337 Original CRISPR CTGGGTCACTAGAAGGAAGT GGG (reversed) Intergenic
No off target data available for this crispr