ID: 1076307205

View in Genome Browser
Species Human (GRCh38)
Location 10:129473881-129473903
Sequence CAGTGGGGCCAGAGGAAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076307197_1076307205 2 Left 1076307197 10:129473856-129473878 CCACTAGAGAGTGGAACGACCAG No data
Right 1076307205 10:129473881-129473903 CAGTGGGGCCAGAGGAAAGATGG No data
1076307190_1076307205 15 Left 1076307190 10:129473843-129473865 CCTACCCCGCACCCCACTAGAGA 0: 1
1: 0
2: 4
3: 31
4: 608
Right 1076307205 10:129473881-129473903 CAGTGGGGCCAGAGGAAAGATGG No data
1076307191_1076307205 11 Left 1076307191 10:129473847-129473869 CCCCGCACCCCACTAGAGAGTGG No data
Right 1076307205 10:129473881-129473903 CAGTGGGGCCAGAGGAAAGATGG No data
1076307193_1076307205 10 Left 1076307193 10:129473848-129473870 CCCGCACCCCACTAGAGAGTGGA 0: 1
1: 0
2: 2
3: 9
4: 108
Right 1076307205 10:129473881-129473903 CAGTGGGGCCAGAGGAAAGATGG No data
1076307189_1076307205 22 Left 1076307189 10:129473836-129473858 CCTTGTGCCTACCCCGCACCCCA 0: 1
1: 0
2: 1
3: 34
4: 361
Right 1076307205 10:129473881-129473903 CAGTGGGGCCAGAGGAAAGATGG No data
1076307196_1076307205 3 Left 1076307196 10:129473855-129473877 CCCACTAGAGAGTGGAACGACCA 0: 1
1: 0
2: 0
3: 1
4: 34
Right 1076307205 10:129473881-129473903 CAGTGGGGCCAGAGGAAAGATGG No data
1076307194_1076307205 9 Left 1076307194 10:129473849-129473871 CCGCACCCCACTAGAGAGTGGAA 0: 1
1: 0
2: 1
3: 11
4: 149
Right 1076307205 10:129473881-129473903 CAGTGGGGCCAGAGGAAAGATGG No data
1076307195_1076307205 4 Left 1076307195 10:129473854-129473876 CCCCACTAGAGAGTGGAACGACC 0: 1
1: 0
2: 0
3: 1
4: 28
Right 1076307205 10:129473881-129473903 CAGTGGGGCCAGAGGAAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076307205 Original CRISPR CAGTGGGGCCAGAGGAAAGA TGG Intronic
No off target data available for this crispr