ID: 1076309550

View in Genome Browser
Species Human (GRCh38)
Location 10:129494895-129494917
Sequence CACAGCACAGAGAAGGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 588
Summary {0: 1, 1: 0, 2: 1, 3: 57, 4: 529}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076309550_1076309556 3 Left 1076309550 10:129494895-129494917 CCAACTTCCTTCTCTGTGCTGTG 0: 1
1: 0
2: 1
3: 57
4: 529
Right 1076309556 10:129494921-129494943 ATAGGGACGTCACCCCTGTGGGG No data
1076309550_1076309554 1 Left 1076309550 10:129494895-129494917 CCAACTTCCTTCTCTGTGCTGTG 0: 1
1: 0
2: 1
3: 57
4: 529
Right 1076309554 10:129494919-129494941 CAATAGGGACGTCACCCCTGTGG No data
1076309550_1076309555 2 Left 1076309550 10:129494895-129494917 CCAACTTCCTTCTCTGTGCTGTG 0: 1
1: 0
2: 1
3: 57
4: 529
Right 1076309555 10:129494920-129494942 AATAGGGACGTCACCCCTGTGGG No data
1076309550_1076309557 8 Left 1076309550 10:129494895-129494917 CCAACTTCCTTCTCTGTGCTGTG 0: 1
1: 0
2: 1
3: 57
4: 529
Right 1076309557 10:129494926-129494948 GACGTCACCCCTGTGGGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076309550 Original CRISPR CACAGCACAGAGAAGGAAGT TGG (reversed) Intronic
900827379 1:4937659-4937681 AACAGCAGAGGGAAGGAAGGAGG + Intergenic
900977447 1:6026326-6026348 CACAGCACCCAACAGGAAGTTGG - Intronic
901228837 1:7630787-7630809 CTGAGCACTGACAAGGAAGTGGG + Intronic
901470596 1:9453861-9453883 CACAGCCCAGAGATGGAGGAGGG + Intergenic
902590315 1:17469334-17469356 TACAGGACAGGGAAGGAAGCTGG + Intergenic
902999717 1:20256456-20256478 CAGAGCACAGAAAAGTGAGTAGG - Intergenic
903358481 1:22762490-22762512 CACTGGACAGAGGAGGAAATGGG - Intronic
904001757 1:27342801-27342823 CAGGGCACAGAGAGGGACGTGGG + Intronic
904272050 1:29356545-29356567 CAGAGCTAAGAGAAGGAAGGAGG + Intergenic
905174578 1:36127500-36127522 CACTGCCCAGAGAAGGGAGGGGG + Intergenic
905461840 1:38127248-38127270 GAAAGCACAGGGAAGCAAGTGGG + Intergenic
905478674 1:38246524-38246546 AACATCATAGAGAAGGAGGTGGG - Intergenic
905912798 1:41665165-41665187 CAGAGCTCAGAGAAAGAAGGTGG + Intronic
906201451 1:43963117-43963139 CATAGCCTAGAGAAGGAAGCAGG + Intronic
907504328 1:54906816-54906838 AAGAGCACAGAGAAGGGAGATGG - Intergenic
907606601 1:55824070-55824092 CACAGCACAAAGATAGAGGTAGG - Intergenic
908024070 1:59929389-59929411 CCCAGCACAGGAAAGAAAGTAGG + Intergenic
908573295 1:65432500-65432522 CACTGGAAAGATAAGGAAGTTGG - Exonic
908710963 1:67013595-67013617 GACAGCAAAGAGGAGGAAGGAGG - Intronic
909383067 1:75023309-75023331 CACAGCAGAGAAAAGCAATTTGG - Intergenic
909433289 1:75614850-75614872 CACTGCAGAGAGGTGGAAGTGGG - Intergenic
910687152 1:89929081-89929103 CATAGGACAAAGAAGGAAGTGGG + Intronic
912117123 1:106420070-106420092 GATAACACAGAGAAGGAATTCGG + Intergenic
912520109 1:110239356-110239378 CTCAGCCAAGAGAAGGAGGTGGG - Intronic
913336151 1:117710458-117710480 CACTGCACAAAGAAGGAGGTGGG + Intergenic
913445864 1:118950117-118950139 CACAGCTCAGAGAAGCAAATAGG + Intronic
915769051 1:158399113-158399135 CACAGCAATGAGGAGGCAGTTGG + Exonic
916413758 1:164574118-164574140 AAAAACACAGAGAAGGAGGTGGG - Intronic
916601091 1:166294280-166294302 AACAGCCCAGAGTAAGAAGTCGG + Intergenic
916651037 1:166834793-166834815 GTCAGCAGAGAGATGGAAGTTGG + Intergenic
917274258 1:173314489-173314511 GGAAACACAGAGAAGGAAGTTGG - Intergenic
917461242 1:175232099-175232121 TCCAGCACAGAGAAAGATGTAGG + Intergenic
918036481 1:180878137-180878159 CACATGAAAGAGAAAGAAGTGGG - Intronic
920284177 1:204867964-204867986 CTCAGCACTGAGTAGGAGGTAGG - Intronic
920423097 1:205849427-205849449 CACAGCAAAGAGTGGGCAGTGGG - Intronic
920553331 1:206884136-206884158 CAAAGCACAGAGAAGAGAGCTGG - Intergenic
920843570 1:209575211-209575233 CACTGCACAGAGAAGGAGCCAGG + Intergenic
920873797 1:209816109-209816131 CACAGCACAGAATAGTAACTGGG - Intergenic
921141117 1:212307513-212307535 AACAGCACAAAGGAGGAGGTGGG - Intronic
921254619 1:213328275-213328297 CACAGCACAGCAAAGTAACTTGG - Intergenic
921308142 1:213817306-213817328 CAGAGGCCAGAGAAGGAAGGCGG + Intergenic
921665354 1:217863504-217863526 CACAGCACTGAGAAGTATTTTGG - Intronic
922005502 1:221526644-221526666 CAGAGCTCTGAGAAGGTAGTTGG - Intergenic
922077869 1:222265928-222265950 AGCAGCACAGAAAAAGAAGTAGG + Intergenic
922533942 1:226365913-226365935 GGCAGGACACAGAAGGAAGTGGG + Intronic
922642499 1:227247536-227247558 GATAACACAGAGAAGGAATTTGG + Intronic
924459785 1:244248731-244248753 AGCAGCACAGAGAATGAAGAAGG + Intergenic
924605453 1:245530715-245530737 CACAGCAGAGATAAAGAACTGGG - Intronic
924912147 1:248525526-248525548 CACAGCTCAGAGAAGAAAAATGG + Intergenic
1063161298 10:3420807-3420829 CACAGCACAGAGCCAGAGGTAGG + Intergenic
1063191093 10:3695734-3695756 CCCAGCAGAGAGATGGGAGTGGG + Intergenic
1063655349 10:7982945-7982967 CACAGTTCAGAAAAGGAAATAGG - Intronic
1064218208 10:13417933-13417955 GACAGCAAAGAGAAGGAAGAGGG - Intergenic
1064680257 10:17804602-17804624 CACAGGAAAGAGAATGAAATTGG - Intergenic
1065726027 10:28668737-28668759 GTCAGCACAGAGGAGGCAGTGGG + Intergenic
1065965408 10:30766554-30766576 ACCAGCACAGTTAAGGAAGTTGG - Intergenic
1066514334 10:36140214-36140236 GATAACACAGAGAAGGAATTTGG - Intergenic
1066839773 10:39894630-39894652 CACAACACAGAGAAGTGACTGGG - Intergenic
1067734709 10:48840586-48840608 CACACCAGTGAGAAGGAAGCGGG + Intronic
1068946550 10:62735297-62735319 CACAGCACAGTGAGGTGAGTAGG - Intergenic
1069566065 10:69464335-69464357 CACAACCCACAGAAGGAAGGTGG - Intronic
1069624571 10:69859931-69859953 CAAAGCCCTGAGAAGGAAGAAGG + Intronic
1069825019 10:71249678-71249700 CAAAGCACAGAGCAGGTAGAAGG + Intronic
1070646252 10:78204296-78204318 TACAGAGCAGATAAGGAAGTGGG + Intergenic
1070652641 10:78249013-78249035 CACAGCACACAGGAGGAAGGAGG - Intergenic
1070804913 10:79265266-79265288 CCCAGCACAGGGAAGCAGGTAGG + Intronic
1071039845 10:81293858-81293880 CACAGCACAGGGCACAAAGTAGG + Intergenic
1071780719 10:88841308-88841330 CAGAGAAGAGAGAAGGCAGTAGG + Intronic
1071963161 10:90825606-90825628 GATAACACAGAGAAGGAATTTGG + Intronic
1072001309 10:91198388-91198410 CACAAAACAGGTAAGGAAGTTGG - Intronic
1072413285 10:95225361-95225383 GACAGTACAGAGAAGCAGGTTGG - Exonic
1072556774 10:96522899-96522921 GACAGGACAGAGAGGTAAGTGGG + Intronic
1072902496 10:99420907-99420929 AACAGAACAGTGAAGGAAATTGG + Intronic
1073280210 10:102348503-102348525 CACAACACTGAGAAGGACCTGGG + Intronic
1073542269 10:104323883-104323905 CACAGTAAAGAGCAGGAAGGTGG - Intronic
1073645928 10:105303942-105303964 GGCAGCACAGAGATGGAAGCAGG - Intergenic
1073996111 10:109317100-109317122 CACAGCACAGAGCCAGAGGTGGG + Intergenic
1074047663 10:109853331-109853353 CACATTACAGAGCAGGAAATGGG + Intergenic
1074114289 10:110443993-110444015 CTCAGCTCAGAGAAAGAAGAGGG + Intergenic
1074834049 10:117272279-117272301 CACATCACAGAGGAGGAAAAAGG - Intronic
1074870329 10:117571043-117571065 CAGAGCACAGAGAAGCTTGTGGG - Intergenic
1075421878 10:122307937-122307959 AACAAGACAGAGAAAGAAGTGGG - Intronic
1075855236 10:125624359-125624381 CAGAGACCAGAGAAGAAAGTGGG + Intronic
1076118723 10:127919470-127919492 CACAGAACAGAACAGGAAGAAGG - Intronic
1076309550 10:129494895-129494917 CACAGCACAGAGAAGGAAGTTGG - Intronic
1076368037 10:129934836-129934858 CTCTGCACAGAGAATGAATTTGG - Intronic
1076619160 10:131775927-131775949 GCCAGCACCGAGAAGGAAGTGGG - Intergenic
1076946708 10:133656573-133656595 CAGAGAGTAGAGAAGGAAGTCGG + Intergenic
1078254169 11:9643101-9643123 CACAGTTCAGAGGAGGAAGTGGG + Intergenic
1078392108 11:10944221-10944243 AACAGCAGACAGCAGGAAGTAGG - Intergenic
1078518256 11:12043382-12043404 CAAGGCACAGAGACGGAACTGGG - Intergenic
1079299721 11:19267194-19267216 AACAGCAGAGAGAAGGAACAAGG - Intergenic
1079625845 11:22617169-22617191 GATAACACAGAGAAGGAATTCGG - Intergenic
1079729157 11:23919567-23919589 GATAACACAGAGAAGGAATTCGG - Intergenic
1082953508 11:58844014-58844036 CACATGACACAGAAGGAAGAAGG + Intronic
1082969909 11:59009274-59009296 CACATGACACAGAAGGAAGAAGG + Intronic
1083644630 11:64165363-64165385 TCCTGCACAGGGAAGGAAGTTGG + Intronic
1084455042 11:69263570-69263592 CACAGCCCAGAGCAGGAAAAGGG - Intergenic
1085041685 11:73330659-73330681 CACAGTACAGACAAGGAATTTGG - Intronic
1085050995 11:73380179-73380201 GTCAGCACAGAGACGGCAGTGGG - Intronic
1085526108 11:77165248-77165270 CACTGCACAGAGCAGGACATAGG - Intronic
1085787349 11:79465267-79465289 CACAGGACAGAGTAGCAAGCTGG - Intergenic
1086070745 11:82796322-82796344 CACAGTAACGAGAAGGAAGGAGG - Intergenic
1086421042 11:86637587-86637609 CACAGCACAGACTAGGGAGTAGG + Intronic
1086549727 11:88042008-88042030 CACAACTCAGAAAAGGAAATTGG + Intergenic
1087584378 11:100099704-100099726 TACATCACAGAGAAGGTAATTGG - Intronic
1089030538 11:115323428-115323450 CACAGCATAAACATGGAAGTGGG + Intronic
1089079309 11:115762555-115762577 CACAGCACAAAGCACGCAGTGGG - Intergenic
1089269523 11:117292067-117292089 CCCAGCAGAGAGAAGGCACTTGG + Intronic
1089269922 11:117295065-117295087 CACTATACAGAGAAGGAATTAGG - Intronic
1089297310 11:117477887-117477909 CAGAGCACTGAGAAGGCAGCCGG - Intronic
1089484373 11:118833484-118833506 TCCAGCAGAGCGAAGGAAGTAGG + Intergenic
1089516986 11:119039354-119039376 CAAAGTACAGAGAAAGAAATCGG + Intergenic
1089980461 11:122767704-122767726 CACAGCACAGAGGACTAAGAAGG + Intronic
1090022674 11:123141524-123141546 CACAGCACAAGGAAGGAGGAAGG - Intronic
1090300977 11:125639328-125639350 AACAGGACAGAGAAAGATGTGGG - Intronic
1090449868 11:126796936-126796958 GCTAGCACAGAGCAGGAAGTGGG + Intronic
1091521779 12:1252764-1252786 CACAACACAGAGACAGAATTTGG - Intronic
1091637677 12:2209978-2210000 CACATGCCAGAGAAGGAAGGAGG + Intronic
1091913362 12:4249995-4250017 CATATTACAGAGAAGGAAATGGG - Intergenic
1093667133 12:21827994-21828016 AACAGAAAAGAGAAGGAAGATGG - Intronic
1093771384 12:23022295-23022317 TACAGCAAAGAGGAGGTAGTAGG - Intergenic
1094027886 12:25978049-25978071 CTCAGCACAGATAAGCAAGTGGG - Intronic
1094764416 12:33575784-33575806 CAAAGCAAATAGAAGGAAGGAGG - Intergenic
1095169817 12:39020517-39020539 CTCAGCAGAGAGAGGGAAGGAGG + Intergenic
1095788849 12:46142786-46142808 GATAACACAGAGAAGGAATTAGG - Intergenic
1095883815 12:47167634-47167656 AGCAGCACAGAGAACGAAGCTGG + Intronic
1095912052 12:47437738-47437760 CAAAGCAAACAGAAGGAAGGAGG + Intergenic
1096792950 12:54056374-54056396 CTCAGCACAGAGGAGGGAGAAGG - Intergenic
1096967426 12:55639346-55639368 CAGAGCCTGGAGAAGGAAGTGGG + Intergenic
1097690410 12:62729299-62729321 CACAGCAAAGGCAGGGAAGTGGG + Intronic
1098975471 12:76897325-76897347 GATAACACAGAGAAGGAATTCGG + Intergenic
1099438667 12:82673563-82673585 AACAGAACAGATAAGGTAGTTGG + Intergenic
1100564578 12:95782963-95782985 TACAGCAAACACAAGGAAGTGGG - Intronic
1101010155 12:100441146-100441168 GAGAGCACAGAGAAGGTAGGAGG - Intergenic
1102068754 12:110000027-110000049 CACTGGACAGAGAAGGAAACAGG + Intronic
1102286872 12:111664797-111664819 CAGAACCCAGAGAAGGCAGTGGG - Intronic
1103402577 12:120653373-120653395 CACAGTATGGAGAAGGAAGCTGG + Intronic
1104700331 12:130898243-130898265 CACAGGAGAAAGAAGGAAGCCGG + Intergenic
1105052372 12:133066114-133066136 GAAAGGAAAGAGAAGGAAGTAGG + Intergenic
1105430348 13:20331494-20331516 GACAGCACCGAGAAGGGAGATGG - Intergenic
1105591128 13:21794015-21794037 TCCAGCACAGAGAAAGATGTAGG + Intergenic
1105810683 13:23992567-23992589 CACAGACCAGAGAAGAATGTTGG + Intronic
1105858004 13:24388534-24388556 AGCAGGACAGAGAAGGAAGAAGG + Intergenic
1106476605 13:30104020-30104042 CAATGCACAAAGTAGGAAGTAGG + Intergenic
1106486693 13:30179068-30179090 CTCTGCACAGAGAAGGCAGCTGG - Intergenic
1106548598 13:30752074-30752096 CAGAGCACAGCGAGGAAAGTGGG - Exonic
1106585188 13:31051086-31051108 AACAGCACAGAAAGGGAAATGGG + Intergenic
1106672628 13:31922897-31922919 CACAGCACAGAGCAGCAGGGAGG - Intergenic
1108573677 13:51772976-51772998 CACAGCAGCGACAAGGAAGGCGG + Intronic
1108756605 13:53510552-53510574 CAGGGCACTGAGATGGAAGTGGG - Intergenic
1108965057 13:56288274-56288296 AAAGGCACAGAGAAGCAAGTTGG - Intergenic
1109119482 13:58436034-58436056 AAAAGCACAAAGAAGGAAGGAGG - Intergenic
1109151075 13:58847909-58847931 CATAGAACAGGGAAGGAAATAGG + Intergenic
1109501196 13:63237746-63237768 CACAACTCAGGGAATGAAGTTGG + Intergenic
1110467146 13:75814950-75814972 ATGAGCACAGAGAAGGAGGTAGG + Intronic
1111078247 13:83266750-83266772 AACAGCACAAAGAAGGTGGTGGG - Intergenic
1111111663 13:83719234-83719256 CAGAGCACAAAGAATAAAGTAGG + Intergenic
1112834766 13:103500868-103500890 CAAAGCCCAGTGTAGGAAGTGGG - Intergenic
1112929955 13:104721588-104721610 AACTGCAGAGAGAAGGTAGTAGG + Intergenic
1113108040 13:106792173-106792195 CTCAGGACAGAGAATGAAGATGG - Intergenic
1113398540 13:109970949-109970971 CACAGCACTGAAAAGGATGTGGG + Intergenic
1113485452 13:110649445-110649467 CACAGCACAGGGGAGGGAGATGG + Intronic
1113618804 13:111699351-111699373 TACAGAACAGGGAAGGAAGGTGG - Intergenic
1113624333 13:111784612-111784634 TACAGAACAGGGAAGGAAGGTGG - Intergenic
1114473138 14:22977494-22977516 CACTGGACAGAGTTGGAAGTAGG - Intronic
1114875209 14:26708803-26708825 CACAGCAAAGAAAAGTAAGCAGG - Intergenic
1114970880 14:28026981-28027003 AACAGAAGAGAGAAGGAAGGAGG + Intergenic
1116916165 14:50528125-50528147 CACAGAAGAGAAAAGGAATTTGG - Intronic
1117458003 14:55917182-55917204 CACACATCAGAGAAGGAGGTGGG + Intergenic
1117611311 14:57485856-57485878 CTCACCTCAGAGGAGGAAGTGGG + Intronic
1117751451 14:58928374-58928396 CTAAGCAAAGAGAAGAAAGTTGG + Intergenic
1118840332 14:69505104-69505126 CACAGCACAGGGAAGGAGGGAGG + Intronic
1119477753 14:74940998-74941020 CAAAGCACTGAGGAGGAAGACGG + Intergenic
1119775606 14:77246455-77246477 CCCAGCACTAAGAAGGAAGAGGG + Intronic
1119809233 14:77502185-77502207 TACAGCGCACAGAAGGAAATTGG - Intergenic
1120106521 14:80501761-80501783 CACACCAAAGAAAAGGAGGTGGG - Intronic
1120275937 14:82371935-82371957 AACAGCAGAGAGAAGGAATTCGG + Intergenic
1120635037 14:86940495-86940517 GACAGCCCAGAGAAGGTATTGGG + Intergenic
1120937625 14:89913193-89913215 CTCAGCTCTGAGATGGAAGTAGG + Intronic
1121236651 14:92396335-92396357 CACAGCAAATTGAAGGGAGTAGG - Intronic
1121322324 14:92999276-92999298 CACAGCACAGAGAGGGTGGCAGG + Intronic
1122074936 14:99229945-99229967 CACAGCCCAGAAAAGGGAGCCGG + Intronic
1123973861 15:25534255-25534277 CACAGCTCAAAGCAGGGAGTAGG + Intergenic
1124108983 15:26769766-26769788 CACAGAACAGAGAGGGAGGGAGG - Intronic
1124702789 15:31931317-31931339 CACAGCACAGGGAAGGAAACAGG - Intergenic
1125044332 15:35229433-35229455 GATATCACAGAGAAGGAATTTGG - Intronic
1126056417 15:44734032-44734054 CAAAGTAGAGAGAAGGAATTTGG + Intronic
1127019142 15:54726594-54726616 GATAACACAGAGAAGGAAGTTGG - Intergenic
1127406788 15:58657582-58657604 GATAACACAGAGAAGGAATTCGG - Intronic
1129736015 15:77964139-77964161 GATAGCACAGAGAAAGAATTTGG + Intergenic
1130566573 15:85001279-85001301 TAGAGCACTAAGAAGGAAGTAGG + Intronic
1131045896 15:89315140-89315162 CCCAGCATACAGAAGGAAGTGGG + Intronic
1131150614 15:90045311-90045333 AACAGCAGAAAGAAGGAAGCTGG + Intronic
1131375270 15:91917933-91917955 CAGAGCACAGGGAATGAAATGGG + Intronic
1131531259 15:93194395-93194417 AACAGCATAAAGAAGGAAGAAGG - Intergenic
1132019295 15:98346464-98346486 CACATCACCAAGAAGGAAGTTGG - Intergenic
1132286026 15:100663222-100663244 CACATCACAGAGAAGCCAGCAGG + Intergenic
1132431944 15:101767689-101767711 CACAGGACAGAGAAAGGAGGCGG - Intergenic
1133114292 16:3567415-3567437 CACTGCATAGAGAAGCAGGTTGG + Intronic
1133422073 16:5654481-5654503 AACACCACAAAGAAGGAAGAAGG - Intergenic
1134303563 16:13012648-13012670 CAGGTCACAGAGAAGGAGGTGGG + Intronic
1134598178 16:15512413-15512435 CCCAGGACATAGAAGGCAGTTGG + Intronic
1134618844 16:15672434-15672456 CACAGCACAGTGAAGAAACAGGG + Intronic
1134837717 16:17376039-17376061 CACTTTACAGAGAAGGAAGTGGG + Intronic
1136416672 16:30108431-30108453 TCCTGCAGAGAGAAGGAAGTGGG + Exonic
1136599022 16:31271728-31271750 GGCAGCACAGAGGAGGAATTTGG + Intronic
1138413584 16:56858481-56858503 CACAGCCCAGAGGAGGAAGCCGG + Intergenic
1138445261 16:57059374-57059396 CAGGGCACAGAGAGGGAAGCGGG - Intronic
1141032819 16:80604344-80604366 CACAGGGCAGAGCTGGAAGTTGG + Exonic
1141185700 16:81785558-81785580 GACAGGATAGAGAAGGATGTTGG + Intronic
1141312328 16:82926507-82926529 CAGAGCAGAGGGAAGAAAGTGGG - Intronic
1141454463 16:84130841-84130863 AAAAGCACATAGTAGGAAGTGGG + Intronic
1141784121 16:86187107-86187129 CACAGCACAAAAATGGGAGTGGG - Intergenic
1142433845 16:90044815-90044837 CACAACACAGAGAAGCAAAAAGG + Exonic
1143831637 17:9656675-9656697 CACAGCTAAGAGAAGGAAGCAGG - Intronic
1144011186 17:11149941-11149963 AACAGCATAATGAAGGAAGTAGG + Intergenic
1144702044 17:17346476-17346498 CAGGGCACGGAGAGGGAAGTCGG + Intronic
1145097894 17:20047366-20047388 ACCAACACAGAGAAAGAAGTGGG - Intronic
1146503949 17:33388454-33388476 CATACCACAGAGAATGAAGGTGG + Intronic
1146811193 17:35904966-35904988 CAGAGGAAAGAGAATGAAGTGGG - Intergenic
1146840761 17:36152534-36152556 CACAGCAAAGAGAATGTAGTTGG - Intergenic
1147306325 17:39566860-39566882 ACCAGCACAAAGGAGGAAGTAGG + Intergenic
1147580562 17:41625150-41625172 CACATCACAGATAAAGAAATTGG + Intergenic
1147794351 17:43031936-43031958 AACAGCGCAGAGAAGGAAGCTGG - Intergenic
1148072753 17:44917635-44917657 CCCAGCACAGAGAGGGAGGTGGG + Intergenic
1148553947 17:48566697-48566719 GACATGACAGAGAAGGAAGAGGG - Intronic
1148683276 17:49486708-49486730 CACAGCACACAGGAGGCAGCAGG - Intergenic
1148741046 17:49892879-49892901 CACAGCACAGGGAAGGGGGCAGG + Intergenic
1148764120 17:50027568-50027590 CACAGCAGAGGGAAGGGAGAAGG - Intergenic
1148846749 17:50534150-50534172 CCAAGCACAGAGAAGGGAGGAGG - Intronic
1149016518 17:51914642-51914664 CATGGCAAAGAGAAGGAAATTGG + Intronic
1149747835 17:59116503-59116525 TACAGAACAGAAAAGGAGGTAGG - Intronic
1149858762 17:60108434-60108456 CACAGCAAAGAGAATGTAGTTGG + Intergenic
1150869870 17:68895619-68895641 CACAGATCTGGGAAGGAAGTGGG - Intronic
1151444965 17:74157475-74157497 CACAGCAGGCAGAAGGAGGTGGG + Intergenic
1151540620 17:74763020-74763042 CAAGGCCCAGAGAAGGAAGTCGG + Intronic
1151551283 17:74823889-74823911 CACCGCACAGACAAGGAACTTGG - Intronic
1151641335 17:75397125-75397147 CTCAGCACAGCCATGGAAGTAGG - Intronic
1151713165 17:75818184-75818206 CACAGCAGAGGGGAGGAAGGGGG - Intronic
1151727574 17:75893622-75893644 CACATCACAGAGGAGGAAACGGG + Intronic
1151770533 17:76157407-76157429 AAAGGCACAGAGCAGGAAGTCGG - Intronic
1151840015 17:76611011-76611033 CACAGCAAAGAGCAGGAGGATGG + Intergenic
1152445166 17:80338270-80338292 CACCGCACTGAGAAGGAGGTTGG + Intronic
1152516825 17:80830164-80830186 CACAGAACAGAGAAGCCAGCGGG - Intronic
1153544806 18:6194616-6194638 CACAGCACATGGAAGGGAGAAGG - Intronic
1153785460 18:8529803-8529825 CAGAGCACTGAGAAGGAACACGG + Intergenic
1156062710 18:33099822-33099844 GGCAGCACAGACAAGGAAGTGGG - Intronic
1156475947 18:37405418-37405440 TACACCACAGAGAAAGAACTGGG - Intronic
1157077466 18:44480809-44480831 CAAAGCCCAGAGAAGGATGGAGG - Intergenic
1157563363 18:48663836-48663858 CACACCACAGGGAAGGAGGGAGG - Intronic
1157600033 18:48888121-48888143 CACAGTGCAGAAAAGGAAGCCGG + Intergenic
1157918811 18:51695500-51695522 CACAGCATAGATAAGCAAGCTGG - Intergenic
1158231327 18:55258954-55258976 CACAGAATAGAGAGGGCAGTGGG - Intronic
1158600033 18:58848845-58848867 CACAGCTCCCAGGAGGAAGTGGG + Intergenic
1159309455 18:66688106-66688128 GACAGGACAGAGAAGGAAAAAGG - Intergenic
1159447030 18:68553885-68553907 CACAGCCCAGACAAAGAAGGAGG + Intergenic
1159917592 18:74200457-74200479 CAAAGAACAGAAAAGGAGGTGGG + Intergenic
1160220869 18:76976734-76976756 CACGGCAGAGAGAAGGACCTCGG - Intergenic
1160586652 18:79916984-79917006 CCCAGCACCGAGCAGGCAGTCGG - Intronic
1161185335 19:2914876-2914898 AACAGCACAGAGGAGGAGGGTGG - Intronic
1161483681 19:4523636-4523658 CAGAGCACAGGGACGGGAGTGGG - Exonic
1161719707 19:5896046-5896068 CAAGGCACACAGAAGGAAGGCGG + Intronic
1162553788 19:11374025-11374047 CGCAGGACAAAGAAGGAAGCAGG - Intergenic
1163761931 19:19142047-19142069 CACAGCACAGAGGATGAAATGGG + Intergenic
1163848599 19:19651140-19651162 CACACCACAGAGGAGGAAGCTGG - Intronic
1164131622 19:22368326-22368348 CAAATGAAAGAGAAGGAAGTAGG + Intergenic
1164465200 19:28481892-28481914 CACAGCTGAGTCAAGGAAGTGGG + Intergenic
1165077449 19:33287847-33287869 CAGTGCACAGAGCAGGGAGTGGG - Intergenic
1165351300 19:35277439-35277461 CACAGCCCAGAGAAGCCAGAGGG + Intronic
1166184230 19:41128958-41128980 CACTGCAGAGAGATGGAAGCAGG + Intergenic
1166921059 19:46229534-46229556 CATAGCACAGAGAAGGTGGAGGG + Intergenic
1168222273 19:54969072-54969094 CATAGATCAGATAAGGAAGTGGG - Intronic
924998768 2:387002-387024 CCCAGGACAGAGAAGGGAGCAGG - Intergenic
925151403 2:1617880-1617902 CAATCCACAGAGCAGGAAGTAGG - Intergenic
925919377 2:8628512-8628534 CATGGCACGGAGAAGGCAGTTGG + Intergenic
925938141 2:8787892-8787914 CACAGCTCAGAGAGGGGAGCTGG + Intronic
926001808 2:9339336-9339358 CACAGGGCAGGGTAGGAAGTGGG - Intronic
926238748 2:11069182-11069204 CTTGGCACAGAGAAGGAAGCGGG - Intergenic
926561955 2:14427270-14427292 CACAGGAAAAAGAAGGAAGCGGG + Intergenic
926819960 2:16841140-16841162 CTAAGAACTGAGAAGGAAGTTGG - Intergenic
927712096 2:25332382-25332404 CAGGGCTCAGAGAAGGAAGTCGG - Intronic
928435235 2:31250684-31250706 CATGGCACAGAGAGGGTAGTGGG - Intronic
929695958 2:44115479-44115501 CACAGCACAAAGAAAGGTGTTGG - Intergenic
930238109 2:48907127-48907149 CACATCGGAGAGAAGGGAGTGGG + Intergenic
931058010 2:58494434-58494456 AACAGGATAGAGAAGGAAGCGGG + Intergenic
931601317 2:64005905-64005927 TACAGTAAATAGAAGGAAGTAGG + Intronic
932176615 2:69608710-69608732 CACAGGACAGAGAAAGAACATGG + Intronic
932362223 2:71118419-71118441 CACAGCTCAGAGCAGGGAGCTGG - Intronic
932444323 2:71765781-71765803 CACAGCACAGTGAAGGAGAGAGG - Intergenic
932621105 2:73265395-73265417 CACAGCACTGAGGGGGAAGAGGG - Exonic
932829988 2:74980011-74980033 CACATCACAGAAGAGGAAGTAGG + Intergenic
933144057 2:78829482-78829504 CTCAGGACAGAGTGGGAAGTAGG - Intergenic
933185288 2:79271443-79271465 CATAGCACAGGGACAGAAGTTGG + Intronic
933330227 2:80884133-80884155 CACAGCACAAAGAGTAAAGTTGG + Intergenic
934059721 2:88282998-88283020 CAGAGCACACAGAATGAGGTGGG - Intergenic
934986296 2:98888363-98888385 AACAGCACAGAAAAGGGAGGAGG + Intronic
936068423 2:109349474-109349496 CACTGGGCAGAGAAGCAAGTTGG - Intronic
936102089 2:109590956-109590978 CCCAGAGCAGAGAAGGAAGATGG + Intronic
936282651 2:111155824-111155846 CCCTGGACAGAGTAGGAAGTAGG - Intronic
936459060 2:112698077-112698099 CAGAGGACAGAGAAGGTGGTAGG - Intergenic
936745440 2:115570953-115570975 CACAGGACGGAGAGGGGAGTCGG + Intronic
936852473 2:116917425-116917447 TACAGCACAGATGAGGAAGCAGG + Intergenic
937026766 2:118705425-118705447 CACAAGCTAGAGAAGGAAGTGGG + Intergenic
937289705 2:120774894-120774916 CACATCACAGAAAAGGATCTGGG - Intronic
937322671 2:120970364-120970386 CAGAGAGCAGACAAGGAAGTGGG - Intronic
937587837 2:123576259-123576281 GACAGGACAGAGAAAGAAATAGG + Intergenic
937776352 2:125781114-125781136 ATCAGCACAGAGAAGGGAGAAGG - Intergenic
938325221 2:130393876-130393898 CACAAAACAGAAAAGGAAGAAGG + Intergenic
938374318 2:130795852-130795874 CCCTGCTCAGAGAAGGAAGGAGG - Intergenic
938394370 2:130931487-130931509 CATACTACAGAGAAGGAAGAGGG - Intronic
939022872 2:136980132-136980154 CACTGCACAGAGGAAGGAGTAGG - Intronic
939198077 2:138998260-138998282 CAGAGTACAGGGAAGGAAGCAGG + Intergenic
939323498 2:140655598-140655620 CAGAGCACAGAGAAGTAGCTAGG + Intronic
939525478 2:143288541-143288563 CACAGCACAGAAAAATAACTCGG - Intronic
939641585 2:144646088-144646110 CCCAGCACTTAGTAGGAAGTTGG - Intergenic
939703733 2:145426010-145426032 AAAAGCACAGACAAGCAAGTGGG + Intergenic
940072818 2:149708656-149708678 CACATAGCAGAGAAGGAGGTGGG + Intergenic
941641389 2:167992438-167992460 CAGAGCAGAAAGAAGGATGTGGG + Intronic
942166912 2:173250370-173250392 CACAGCAGGGAGAAGGAAATAGG + Intronic
942794506 2:179801489-179801511 CTTAGCACAGAGGAGGGAGTTGG - Intronic
943600979 2:189920660-189920682 CACAAGACACAGAAGAAAGTGGG - Intronic
943816136 2:192258235-192258257 CACAGCACAGAGAATGCTTTTGG - Intergenic
943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG + Intergenic
944424970 2:199571427-199571449 CACTGCACTGTGAAAGAAGTCGG + Intergenic
944661017 2:201921580-201921602 CACTGAACTGAGAGGGAAGTGGG - Intergenic
945216391 2:207438576-207438598 CACAACACAGTGACAGAAGTGGG + Intergenic
946204341 2:218092668-218092690 CAAAGCCCAGAGAAGCATGTGGG + Intergenic
946352307 2:219163291-219163313 CAAAGCCCAGAGAAGGCTGTGGG + Intronic
946673464 2:222131401-222131423 CACAGCAGATGGAAGAAAGTTGG + Intergenic
947058952 2:226140028-226140050 CATGGCACAGAGCAGGAAGGTGG - Intergenic
947432426 2:230042849-230042871 TATAGCAGGGAGAAGGAAGTGGG - Intronic
948855654 2:240729396-240729418 AAGGGCACAGAGAAGGGAGTAGG - Intronic
1168857023 20:1015700-1015722 TACAGAACAGAGCAGGAAGTTGG - Intergenic
1169029493 20:2396636-2396658 CACAGGCCAGACAAGGATGTGGG + Intronic
1169367664 20:5003964-5003986 CACATCACTGAGAGGGAAGGGGG - Intronic
1169896968 20:10514368-10514390 AACAGAACAGAGAAAGAAGTTGG - Intronic
1170180426 20:13523779-13523801 CACAGCAGAAACAAGGTAGTAGG + Intronic
1170725517 20:18922882-18922904 GACACCACAGAGAAGGAAACTGG - Intergenic
1170903522 20:20489187-20489209 TACAGCACAGAGGAAGCAGTCGG + Intronic
1171345162 20:24460271-24460293 CAGAGCCCAGAGAAGTAAGCAGG - Intergenic
1172127033 20:32630593-32630615 CACAGCACGGAGGAGGAGGCAGG + Intergenic
1172220966 20:33274863-33274885 TATGGCACAGAGAAGGAAATGGG - Intronic
1172306891 20:33887071-33887093 CAGAGAACAGGGAAGGCAGTGGG + Intergenic
1172486539 20:35301688-35301710 CACAGTACAGTGTAGGAGGTGGG + Intergenic
1172882116 20:38208866-38208888 CAGTGCACAGAGAGGGAAGCAGG + Intergenic
1173297884 20:41775409-41775431 CAGACCGCAGAGATGGAAGTTGG + Intergenic
1173447619 20:43134170-43134192 CACAACAAAGAAAAGGAAGGGGG + Intronic
1173449869 20:43153818-43153840 CTCAGCACAGAGAAGGCAAGAGG + Intronic
1174277298 20:49413362-49413384 CATAGTACAGAGCAGGTAGTGGG - Intronic
1174477291 20:50804839-50804861 CACTGCCCAGAGAAGAAACTCGG - Intronic
1174894263 20:54431714-54431736 CACTGAACAGAGCAGGGAGTAGG + Intergenic
1175164814 20:57035962-57035984 CACAGTACAGAGGTGGAACTTGG - Intergenic
1175302226 20:57951154-57951176 CACAGCGCAGTGCAGGGAGTGGG + Intergenic
1178603984 21:34019132-34019154 CACAGCAGTGAGAAGGGAGCAGG - Intergenic
1178689072 21:34736151-34736173 CACAGAGCAGAGAAGCAACTAGG - Intergenic
1178993414 21:37374932-37374954 CACATATTAGAGAAGGAAGTGGG + Intronic
1179116058 21:38493801-38493823 CACAGGACAGGGAAGGAAGGAGG - Intronic
1179287202 21:39987755-39987777 CTCAGCAAGGAGAAGGAAATAGG + Intergenic
1179682124 21:43030018-43030040 GACAGCACAGAGGAGGATGCGGG + Exonic
1180719896 22:17900244-17900266 CACAGCACAGGGCAGGCATTGGG + Intronic
1180867059 22:19125754-19125776 CACAAACCAGAGAAGGAAGACGG + Intergenic
1181043855 22:20205426-20205448 CCCAGCACACAGGAGGCAGTGGG - Intergenic
1181885672 22:26020412-26020434 AACAGCACAGAGAAGGGAAGTGG - Intronic
1181904861 22:26186274-26186296 TCCTGAACAGAGAAGGAAGTGGG + Intronic
1182341850 22:29629018-29629040 CACAGCAAAAAGAGGGGAGTGGG - Intronic
1183329130 22:37210088-37210110 CACAGCACAGGGCAGCAAGGTGG - Intronic
1183476960 22:38041015-38041037 CTCAACACAGTGAAGGAAGACGG + Intronic
1183569033 22:38638274-38638296 CAGAGGACTGAGCAGGAAGTGGG + Intronic
1183704052 22:39466116-39466138 GAAAGCACAGAGAAAGAAGCAGG - Intronic
1184034647 22:41912715-41912737 CCCAGCAGAGAAAAGGGAGTTGG + Intronic
1184281377 22:43439533-43439555 CACAGCAAAGAGGAGGAAACAGG - Intronic
1184662844 22:45973342-45973364 CACAGCACAAAGCAGGAAGATGG + Intronic
1184931007 22:47681412-47681434 CCCAGCTCAGAGCAGGAAGAAGG - Intergenic
1185412978 22:50695574-50695596 CACAGCCCAGAGAGGCCAGTGGG - Intergenic
950631902 3:14287494-14287516 CACAGCACAGATGAGGAAACCGG - Intergenic
950671166 3:14526240-14526262 CACTGTACAGATAAGGAAGCTGG + Intronic
951197132 3:19836642-19836664 CAGAGCACTGAGAAGGAACATGG + Intergenic
951512099 3:23513696-23513718 CACAGCACTGATAAGGATGTAGG - Intronic
951800467 3:26590111-26590133 CACAGAACAGAGAAAGAGGCAGG - Intergenic
952415656 3:33089077-33089099 CACAGGCAAGAGAATGAAGTTGG + Intronic
952662183 3:35865141-35865163 CACTCCACAGGGAAGGGAGTGGG - Intergenic
952970345 3:38646832-38646854 CACTTGACAGAGAAGGAAGATGG + Intronic
953085637 3:39664042-39664064 CACAACACATGGAAAGAAGTGGG + Intergenic
953477639 3:43219212-43219234 CAGAGCACAGTGAAACAAGTGGG + Intergenic
953583847 3:44181701-44181723 CACAGGAAAGAGAAGGCAGGGGG + Intergenic
953903949 3:46858859-46858881 CACAGCACACAGAAGTACGGAGG - Intronic
954322901 3:49844062-49844084 CACATCCCAGAGAAAGAAGCGGG - Intronic
954414623 3:50387155-50387177 CTCAGCACAGGGAAGGGAGCTGG + Intronic
955696810 3:61645290-61645312 CACAGCATAGAAAAGGAATGCGG - Intronic
955828593 3:62976536-62976558 CACAGCACTTAGAAGCTAGTAGG - Intergenic
956050710 3:65245285-65245307 CAAAGCAAAGACAAGGAAGTTGG + Intergenic
956407886 3:68948056-68948078 CACAGGAAGGAGAAAGAAGTTGG + Intergenic
957238850 3:77630852-77630874 AACAGCACAGGGAAGGGACTGGG + Intronic
957309268 3:78498748-78498770 CACAGCACACATGAGCAAGTGGG + Intergenic
957790868 3:84939672-84939694 CACAGGGCAGAGAGGGAAGAAGG + Intergenic
957952545 3:87144824-87144846 CACAGCACAGAGAAGCATAGCGG + Intergenic
958147262 3:89641316-89641338 GATAACACAGAGAAGGAATTTGG + Intergenic
958659829 3:97052358-97052380 CACTCCTCAGAGTAGGAAGTAGG - Intronic
958876854 3:99625942-99625964 GATAACACAGAGAAGGAATTCGG + Intergenic
958943176 3:100336408-100336430 CAAAGTATAGAGAAAGAAGTAGG + Intronic
959594474 3:108114378-108114400 GACAGCAAAGGGAAGGAAGCAGG - Intergenic
960699593 3:120427249-120427271 CAAAGTTCAGAGAAGGAAGGGGG - Intronic
962166608 3:133055779-133055801 CCCATCACAGACAAGGAAGAAGG + Intronic
962279222 3:134037637-134037659 CACTGCACAGAGAAGAAGTTAGG - Intronic
962620202 3:137170447-137170469 AACAGCACAGAGCAGGATCTAGG + Intergenic
963078580 3:141370508-141370530 CACAGCACATAAAAGAAACTTGG + Intronic
964820003 3:160757815-160757837 CAGAGGGCAGAGAAGAAAGTTGG - Intronic
965614991 3:170585067-170585089 CACAGGAGAGAGAAGGAGGGTGG + Intronic
967483871 3:190007261-190007283 CATATAACAGAGAAGTAAGTTGG + Intronic
967972936 3:195012512-195012534 CACAGCACAGAGAATGACCTGGG + Intergenic
968559549 4:1271741-1271763 TCCAGCACAGAGAAAGATGTAGG + Intergenic
968643197 4:1725348-1725370 CAGGGCCCAGAGAAGGATGTAGG - Intronic
968944207 4:3655056-3655078 CCCATCACAGAGAAGGAAGCAGG - Intergenic
969136515 4:5033441-5033463 CACACCCCAGGGCAGGAAGTGGG + Intergenic
969632126 4:8345032-8345054 CACAGCAGAGAGAAGGATCCAGG + Intergenic
969955450 4:10885487-10885509 CATAGTACAGAGAAGGGAATTGG + Intergenic
970293057 4:14597587-14597609 CAGAGCTCAGAGAAGAAAGAAGG - Intergenic
971503211 4:27338866-27338888 CACATCACAAACAAGGAAGGGGG + Intergenic
971728946 4:30351058-30351080 CCCACCACAGAGAAGGTAATAGG - Intergenic
971876052 4:32309834-32309856 AAGAGCACAAAGAAGGAACTGGG - Intergenic
972663629 4:41142714-41142736 CAGAGAAGAGAGAAGGACGTTGG - Intronic
972865340 4:43225482-43225504 CACTGCACAGAGCAGGATGGAGG + Intergenic
973559919 4:52124923-52124945 CAGAGCACAGAGCAGGGAGAAGG - Intergenic
973631787 4:52826446-52826468 CACAGTGCAGAGAATGAATTGGG - Intergenic
974391067 4:61269287-61269309 CACACCAGAGAAAAGGAAGAAGG - Intronic
974442042 4:61931362-61931384 CACAGTACAGTGTAGGAAGAAGG - Intronic
975954535 4:79821896-79821918 CATAGCAAAGAGCAGGAAGAAGG + Intergenic
976093809 4:81486628-81486650 CAGAGCACACAGAAGGAGGGAGG + Intronic
976781295 4:88761544-88761566 CACATCACACAGAAGGAAGGAGG + Intronic
976914425 4:90353100-90353122 CACACCTCAGGGAAGGAAGTGGG - Intronic
978290323 4:107130272-107130294 GACATCAGAGGGAAGGAAGTCGG + Intronic
978332585 4:107630463-107630485 CACAGGAAAGAGAACAAAGTGGG - Intronic
978355429 4:107867468-107867490 TACAGCAAAGAAAAGGAAATGGG - Intronic
978891556 4:113834463-113834485 CACAGCATAGAGAAGAATATCGG + Intergenic
979084493 4:116389554-116389576 AACAAGACAGAGAAGGAAGAAGG + Intergenic
979464166 4:121017306-121017328 CACAGCACAGAGAAGAACCTGGG - Intergenic
979595538 4:122530412-122530434 CACTTCACAGCAAAGGAAGTTGG - Intergenic
983873685 4:172851652-172851674 CACAGAAGATAAAAGGAAGTTGG + Intronic
983885886 4:172980119-172980141 CACCTCACAGAAAAGGAATTAGG + Intronic
984373933 4:178902318-178902340 CCCAACACACAGAAGGAAATAGG + Intergenic
984869137 4:184311335-184311357 CACAGCACAGAGCAAGAATGGGG - Intergenic
985009748 4:185570241-185570263 CAGAGCACAGAGGAAGCAGTAGG + Intergenic
985011471 4:185587389-185587411 CAAAGCTTAGAGCAGGAAGTAGG + Exonic
985224068 4:187740230-187740252 AAAAGCACAGAGCAGCAAGTTGG + Intergenic
985422273 4:189796013-189796035 CACACCACAAAGAAGTAATTAGG - Intergenic
985450164 4:190057372-190057394 CAGAGAGTAGAGAAGGAAGTCGG + Intergenic
986756486 5:10840983-10841005 GACAGCACAGGGAAGGAATTCGG + Intergenic
987005267 5:13703961-13703983 CACAGCAGAGGGAAGGGAGATGG - Intronic
987056478 5:14198285-14198307 GACAGCAGAGAGAGGGAAATGGG - Intronic
988145941 5:27308389-27308411 CACTGCACAAAGAAACAAGTGGG + Intergenic
988321069 5:29697526-29697548 CAGAGCACAGAGATAGTAGTGGG + Intergenic
988790118 5:34600101-34600123 AAAAGCATAGAGAAGGAAGAAGG + Intergenic
990393943 5:55356157-55356179 GAAGGCACAGAGAAGGAAGTGGG + Intronic
991421112 5:66443162-66443184 CAAAGCACAGATAAGGAAGATGG + Intergenic
992070235 5:73141529-73141551 CATAGCACAGAGCAAGGAGTTGG + Intergenic
992332116 5:75728196-75728218 CATAGCTCAAAGAAGGGAGTAGG + Intergenic
993407652 5:87531538-87531560 CACAAAAGAGAGAAGGAAGGAGG - Intergenic
994245895 5:97475950-97475972 CACAGGACAGAGAAAGAAAATGG - Intergenic
995809454 5:116088176-116088198 CACTGCACAGAGCAGTTAGTGGG - Intronic
996966851 5:129316597-129316619 CCAACCACAGAGAAGGGAGTAGG + Intergenic
997208860 5:132066197-132066219 AAAAGCACAGGGAAGGAAGGAGG + Intergenic
997378017 5:133411326-133411348 CACAGCACAAAGAAGGCTTTTGG + Intronic
997669970 5:135662758-135662780 GACAGAACAGAGAAAGAAGCTGG - Intergenic
998374063 5:141680050-141680072 GACTGCTCAGAGGAGGAAGTGGG + Exonic
999528593 5:152436371-152436393 CACAGGAGAGAGAATGAAGGAGG - Intergenic
999623077 5:153491553-153491575 GACAGCAAAGAGAAGGCAGCTGG - Intronic
999878756 5:155837605-155837627 AACAGAACAGGGAAGGAAGGAGG - Intergenic
1000361670 5:160453369-160453391 CTGAGCACAGAAACGGAAGTAGG - Intergenic
1001683778 5:173577462-173577484 CACAGCAGGGAGGAGGAAGATGG + Intergenic
1001692362 5:173642566-173642588 CAAAGCCCAGAGATGGGAGTCGG + Intergenic
1003065974 6:2903590-2903612 GACAGCCCAGAGAAGTAGGTTGG + Intergenic
1003086210 6:3063638-3063660 GACAGCCCAGAGAAGTAGGTTGG - Intergenic
1003406278 6:5829475-5829497 CACAACACAGACATAGAAGTTGG - Intergenic
1003535582 6:6972754-6972776 CACAGCAGAGAGAAAAAAGACGG - Intergenic
1003778600 6:9397864-9397886 CACAGCAGAGAGGAGTGAGTGGG - Intergenic
1004339357 6:14794732-14794754 CACAGCCCTGAAAAGGCAGTAGG + Intergenic
1004408831 6:15361409-15361431 GAAAGGACAGAGGAGGAAGTGGG - Intronic
1004576962 6:16905850-16905872 CACAGAAGAGGGAAGGAAGCTGG - Intergenic
1006417291 6:33912220-33912242 AACAGAACAGAGTTGGAAGTAGG + Intergenic
1007655823 6:43450529-43450551 CACAGCACTGTGATGGAGGTGGG - Exonic
1007817366 6:44534143-44534165 CTCAGCAAAGGGATGGAAGTTGG + Intergenic
1008230643 6:48982378-48982400 CAAACCACTGAGAGGGAAGTGGG + Intergenic
1009329571 6:62400372-62400394 GATAACACAGAGAAGGAATTTGG - Intergenic
1010085316 6:71910565-71910587 CAGAACACAGTGAAGGGAGTAGG - Intronic
1010289879 6:74123070-74123092 AAAAGCACAAAGAAGGAGGTGGG - Intergenic
1010636321 6:78262978-78263000 CACAGCAAAGATAAGGAAGTCGG + Intergenic
1011412321 6:87078732-87078754 CCTAGCACAGAGAAAAAAGTAGG + Intergenic
1011596352 6:89020333-89020355 CAGAACACAAACAAGGAAGTAGG + Intergenic
1012811079 6:103959059-103959081 CACAGCAGAGAGAAAGAGGAAGG + Intergenic
1014141731 6:117951661-117951683 CACAGCACAAAGAAGCAAACTGG - Intronic
1014296805 6:119628430-119628452 CACAGCACAGGAAAGGTAGAAGG - Intergenic
1014343252 6:120234211-120234233 CACAGCACAGAGAAAAGTGTGGG - Intergenic
1014703187 6:124714915-124714937 CACAGCCCAGTGATGGCAGTAGG + Intronic
1014835218 6:126153703-126153725 CACATCACAGATAATAAAGTAGG + Intergenic
1015841062 6:137477849-137477871 CATTGCACAGAGAAGGAAACAGG + Intergenic
1017960924 6:159219529-159219551 CACTTCACAGACAAGGAAGCGGG - Intronic
1018472841 6:164111889-164111911 CACAGCTCAGAGAGGGAAAAGGG + Intergenic
1018762078 6:166901519-166901541 CACAGTAAAGAGAAGGCCGTGGG + Intronic
1018793485 6:167168593-167168615 CGCAGCACAGAGAGGGATGCGGG + Intronic
1018823230 6:167389785-167389807 CGCAGCACAGAGAGGGATGCGGG - Intergenic
1019598956 7:1871949-1871971 CACAGGACAGAGAAAGCAGAGGG + Intronic
1019659546 7:2216358-2216380 CACGGCTAAGAGAAGGAAGCCGG + Intronic
1020485223 7:8713338-8713360 GATAACACAGAGAAGGAATTCGG - Intronic
1020549442 7:9583685-9583707 CACAGGATAAGGAAGGAAGTAGG - Intergenic
1021842834 7:24734544-24734566 GATAACACAGAGAAGGAATTTGG + Intronic
1022319980 7:29279027-29279049 CATTGCAGAGAGAAGGAAGCAGG - Intronic
1022879349 7:34569828-34569850 GACAGCTCAGAGGAGGAAGCAGG + Intergenic
1023268814 7:38437264-38437286 TACATCACAGAAAAGGGAGTTGG + Intronic
1023429874 7:40079593-40079615 CACTTCACAGAGGAGGAAGCAGG + Intronic
1023634651 7:42197613-42197635 CTCAGTACAGAGAAGGATGGGGG + Intronic
1023658732 7:42451977-42451999 TATAGCACAGAGAAAGAAATAGG + Intergenic
1023809665 7:43902099-43902121 GACAGAACAGAGAAGGGAGGAGG + Intronic
1024626923 7:51215801-51215823 CACAGGACAGAGAGGGATGAGGG + Intronic
1025224324 7:57143585-57143607 TAGAGCACAGAAAAGTAAGTGGG - Intergenic
1025610563 7:63072720-63072742 CACAGCACAGATGAGGCTGTGGG - Intergenic
1025721924 7:64024948-64024970 CACAGCTTAGAGAAGGGATTGGG + Intergenic
1026183466 7:68062460-68062482 CATAGCTCAAAGAAGGAAGTAGG - Intergenic
1026568733 7:71511246-71511268 GAATGCACAGACAAGGAAGTGGG + Intronic
1026785766 7:73300774-73300796 CACAGCCCAGGGATGGGAGTTGG + Intergenic
1027108299 7:75419162-75419184 CACAGCCCAGGGATGGGAGTTGG - Intronic
1030114823 7:106055118-106055140 CACAGGAGAGGAAAGGAAGTTGG - Intergenic
1031415865 7:121495734-121495756 CTCAGCACAGAAAAGAAAGTAGG + Intergenic
1032251439 7:130261322-130261344 GACAGCACAGAGAAGGAAAAAGG - Intergenic
1032613816 7:133444262-133444284 CAGAGCACAGGGTAGCAAGTGGG + Intronic
1035231076 7:157466055-157466077 CACAGCAGAGAGAAAGAAACTGG - Intergenic
1035669826 8:1408853-1408875 CAGGGCACAGAGAAGAAAGCTGG + Intergenic
1035854351 8:2958328-2958350 CAAAGTACAGAGAATTAAGTGGG - Intronic
1036469764 8:9042179-9042201 CACAGAAAAGAGAAGGAACTTGG + Intronic
1037011296 8:13846109-13846131 CACAGGACGGAGAAAGAAATTGG - Intergenic
1038201870 8:25420416-25420438 CACAGAACAAAGAAAAAAGTGGG - Intronic
1038510991 8:28135422-28135444 CTCAGCCCAAAGCAGGAAGTTGG - Intronic
1041091321 8:54303685-54303707 CCTAGCACAGAGGAGGGAGTGGG - Intergenic
1042927691 8:73983284-73983306 CAAAGGACAGAGAAGCAAGCAGG - Intergenic
1043615010 8:82114631-82114653 CCCAGCAAAGCCAAGGAAGTGGG - Intergenic
1043861755 8:85325694-85325716 CACAGAACAGAGAAGGACCACGG + Intergenic
1044532401 8:93322296-93322318 AAAATCAAAGAGAAGGAAGTTGG + Intergenic
1045548884 8:103152608-103152630 CCCAGCACAGAGTAGGCACTCGG + Intronic
1046833110 8:118768928-118768950 CACAGGACTGAGAAGGGGGTTGG - Intergenic
1046930526 8:119837337-119837359 CACAGGACTGCAAAGGAAGTAGG + Intronic
1048295398 8:133210125-133210147 CACAGCACAGAGCACACAGTAGG - Intronic
1048438317 8:134438958-134438980 AACAGGAAGGAGAAGGAAGTGGG - Intergenic
1048518463 8:135132242-135132264 CACAGTACAGAAAATGCAGTTGG + Intergenic
1048750502 8:137668176-137668198 CAGAACAAAGAGAATGAAGTAGG + Intergenic
1048995728 8:139792673-139792695 CACTGCACAAGGAAGGAAGCAGG + Intronic
1050946540 9:11527866-11527888 CCCAGCACATAGTAGGCAGTCGG + Intergenic
1050984711 9:12067620-12067642 CACAGAAAAGAGAAAGAAGATGG + Intergenic
1051219104 9:14830048-14830070 CACAAGTCAGAGAAGAAAGTGGG + Intronic
1051808817 9:21027636-21027658 CACAGCTCCGTGAAGGAAGAAGG + Intronic
1052037306 9:23696989-23697011 CACAGGACTGAGAAGGTACTGGG - Intronic
1052470110 9:28883142-28883164 CAGAGCACAGAGAGTGAAGGAGG - Intergenic
1055285574 9:74724928-74724950 AACAGCATAGGGAAGGAAGGGGG - Intronic
1055913946 9:81380955-81380977 CATGGAACAGAGAAGGAAGGCGG + Intergenic
1056206060 9:84320527-84320549 TACAGCACAGGAAAGGAAGGAGG - Intronic
1056222573 9:84464920-84464942 CACAGCAGGGAGAAGGACTTAGG - Intergenic
1056335059 9:85560171-85560193 CTTAGCAAAGTGAAGGAAGTTGG - Intronic
1056617798 9:88183565-88183587 GACAGCACAGGGAGGGGAGTGGG + Intergenic
1056794459 9:89648062-89648084 CACAGCACAGACAAGGGGGAGGG - Intergenic
1059098024 9:111439894-111439916 CACAGCAAGGAGAAGGAAGGAGG + Intronic
1059676728 9:116547575-116547597 CACTTCACAGATAAGGAAGTAGG - Intronic
1061518962 9:131106172-131106194 CACAGTACTGAGGAGGAAGTGGG - Exonic
1062556898 9:137117122-137117144 CAAAGTATAGAGAAGGCAGTGGG - Intergenic
1186451448 X:9677161-9677183 CCCAGCACTGAGAGGAAAGTGGG + Intronic
1186470813 X:9820867-9820889 TACAGCACAGAGGAGTAATTTGG - Intronic
1189909017 X:45790769-45790791 CACAGCTCATAGAAGGTGGTTGG + Intergenic
1190397970 X:50003796-50003818 CACAGCCTAGAGAAGGAAGGGGG + Intronic
1192186076 X:68947732-68947754 CCCAGCACAGAGTAGGTATTTGG + Intergenic
1192450276 X:71240491-71240513 CACAGGGCAGAGAAGGCAGCTGG + Exonic
1193269737 X:79515291-79515313 GAGAGGACAGAGAAGGAAGGAGG - Intergenic
1193351774 X:80472282-80472304 CACAGGAGAGAGCAGGATGTGGG - Intergenic
1193501256 X:82277361-82277383 CACAGCAAAGCCAAGGGAGTGGG + Intergenic
1193981775 X:88189113-88189135 GATAACACAGAGAAGGAATTTGG + Intergenic
1194413650 X:93583798-93583820 GATATCAAAGAGAAGGAAGTTGG + Intergenic
1194692744 X:97008307-97008329 GATAACACAGAGAAGGAATTTGG - Intronic
1195026447 X:100882291-100882313 CACAGCCCTGTGATGGAAGTAGG - Intergenic
1195369183 X:104156424-104156446 CCCAGCACAGAGCAGGTACTTGG + Intronic
1195458649 X:105098982-105099004 CAATGCACAGAGAATAAAGTTGG - Intronic
1197052422 X:122076288-122076310 GATAACACAGAGAAGGAATTCGG - Intergenic
1198040522 X:132847180-132847202 CACAGTACAGAGAAAAAATTTGG + Intronic
1198162316 X:134019820-134019842 GAGAGCACAGAGTAGGAGGTTGG - Intergenic
1198300902 X:135333415-135333437 AGCAGTATAGAGAAGGAAGTAGG + Intronic
1198974879 X:142325509-142325531 AACAGCACAGAGTAGCAAGCTGG - Intergenic
1199845450 X:151689535-151689557 GATAACACAGAGAAGGAATTCGG + Intergenic
1200777725 Y:7184486-7184508 CATAGCACAAAGCAGGAACTAGG + Intergenic
1201646191 Y:16235105-16235127 CACAGAACAGAGAAGAATGTGGG + Intergenic
1201656622 Y:16350212-16350234 CACAGAACAGAGAAGAATGTGGG - Intergenic
1201910292 Y:19127088-19127110 GACAAGACATAGAAGGAAGTTGG - Intergenic
1202050325 Y:20774264-20774286 CACATCACAGAGAAAGAATCTGG - Intronic