ID: 1076310382

View in Genome Browser
Species Human (GRCh38)
Location 10:129502071-129502093
Sequence GCCCAGACCCGTAGTGGGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076310374_1076310382 22 Left 1076310374 10:129502026-129502048 CCTGTGGCATCAAGCTTGCATGA 0: 1
1: 0
2: 0
3: 6
4: 80
Right 1076310382 10:129502071-129502093 GCCCAGACCCGTAGTGGGTTTGG No data
1076310379_1076310382 -8 Left 1076310379 10:129502056-129502078 CCGCTGCTGGGGCTAGCCCAGAC 0: 1
1: 0
2: 0
3: 13
4: 161
Right 1076310382 10:129502071-129502093 GCCCAGACCCGTAGTGGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076310382 Original CRISPR GCCCAGACCCGTAGTGGGTT TGG Intronic
No off target data available for this crispr