ID: 1076312290

View in Genome Browser
Species Human (GRCh38)
Location 10:129517188-129517210
Sequence CCTCGCTGTCCAGGAGCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 155}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076312290_1076312296 -6 Left 1076312290 10:129517188-129517210 CCCATGGCTCCTGGACAGCGAGG 0: 1
1: 0
2: 1
3: 13
4: 155
Right 1076312296 10:129517205-129517227 GCGAGGGGCAGTCTTCTGAATGG No data
1076312290_1076312300 22 Left 1076312290 10:129517188-129517210 CCCATGGCTCCTGGACAGCGAGG 0: 1
1: 0
2: 1
3: 13
4: 155
Right 1076312300 10:129517233-129517255 AGAGGTCCTGTGGTCCTCTTTGG No data
1076312290_1076312297 4 Left 1076312290 10:129517188-129517210 CCCATGGCTCCTGGACAGCGAGG 0: 1
1: 0
2: 1
3: 13
4: 155
Right 1076312297 10:129517215-129517237 GTCTTCTGAATGGACCTCAGAGG No data
1076312290_1076312302 29 Left 1076312290 10:129517188-129517210 CCCATGGCTCCTGGACAGCGAGG 0: 1
1: 0
2: 1
3: 13
4: 155
Right 1076312302 10:129517240-129517262 CTGTGGTCCTCTTTGGCCAGAGG No data
1076312290_1076312298 12 Left 1076312290 10:129517188-129517210 CCCATGGCTCCTGGACAGCGAGG 0: 1
1: 0
2: 1
3: 13
4: 155
Right 1076312298 10:129517223-129517245 AATGGACCTCAGAGGTCCTGTGG No data
1076312290_1076312303 30 Left 1076312290 10:129517188-129517210 CCCATGGCTCCTGGACAGCGAGG 0: 1
1: 0
2: 1
3: 13
4: 155
Right 1076312303 10:129517241-129517263 TGTGGTCCTCTTTGGCCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076312290 Original CRISPR CCTCGCTGTCCAGGAGCCAT GGG (reversed) Intronic
900094874 1:936284-936306 CCCCTCCGTCCAGGAGCCCTAGG - Intronic
900094923 1:936401-936423 CCCCTCCGTCCAGGAGCCCTAGG - Intronic
900386713 1:2413969-2413991 CCTCTGTGTCCAGGAGACACGGG - Intergenic
900802305 1:4744986-4745008 CCTCCCTGTCCTGGGGCCAGTGG + Intronic
901022758 1:6263289-6263311 CCTCGCTCTCCAGGGGCCAGAGG + Intergenic
901023306 1:6266007-6266029 CCTCGCCGGCCTGGAGCCAATGG + Intronic
901963342 1:12845173-12845195 CCTTGCTATCCAGGATCCACTGG + Intergenic
901963879 1:12850089-12850111 CCTTGCTATCCAGGATCCACTGG + Intronic
901968441 1:12887549-12887571 CCTTGCTATCCAGGATCCACTGG + Intronic
901976529 1:12948927-12948949 CCTTGCTATCCAGGATCCACTGG + Intronic
901983841 1:13057821-13057843 CCTTGCTATCCAGGATCCACTGG + Intergenic
901990538 1:13109505-13109527 CCTTGCTATCCAGGATCCACTGG + Intergenic
901991514 1:13118197-13118219 CCTTGCTATCCAGGATCCACTGG + Intergenic
901996923 1:13159448-13159470 CCTTGCTATCCAGGATCCACTGG + Intergenic
901997971 1:13168948-13168970 CCTTGCTATCCAGGATCCACTGG - Intergenic
902008642 1:13252843-13252865 CCTTGCTATCCAGGATCCACTGG - Intergenic
902016732 1:13314234-13314256 CCTTGCTATCCAGGATCCACTGG - Intronic
902608034 1:17580131-17580153 CCTGGCTGCCCAGGAAGCATGGG - Intronic
903901038 1:26645517-26645539 CCTCCATGTCCAGGACCCTTGGG + Intergenic
904643022 1:31944738-31944760 GCTCGCTGTCCCGGTGCCAGCGG + Intronic
905182484 1:36175789-36175811 CCTCACTGTCCTGAATCCATGGG + Intronic
905304609 1:37008744-37008766 CCTCGCTGTCCTGGAGGCAGTGG - Intronic
906901949 1:49844969-49844991 CCTTGTTGTTCAGGAGTCATTGG - Intronic
907554805 1:55334542-55334564 TCTCCCTGCCCAGGAGCCACTGG - Intergenic
908172158 1:61516103-61516125 CCTCGGTGTCCATGAGGGATTGG + Intergenic
912225437 1:107728174-107728196 ATTCCCTGTCCAGGAGCCAGTGG - Intronic
912515787 1:110215889-110215911 CCTCTCTGGGCAGGAGCCAGAGG - Intronic
919778404 1:201208326-201208348 TCTGGGGGTCCAGGAGCCATGGG + Exonic
921544386 1:216456805-216456827 ACTCTCTGTCCAGGAGCCTCTGG - Intergenic
1066520229 10:36209585-36209607 CCTTGCTTTACAGGAGCAATAGG - Intergenic
1070706073 10:78639811-78639833 CCTTGCAACCCAGGAGCCATGGG + Intergenic
1070721966 10:78763156-78763178 CCAGGCTGTCCAGGAGACGTGGG - Intergenic
1071817853 10:89251421-89251443 CCTCGCGGTCCAGGAGCACTGGG + Intronic
1074068734 10:110044346-110044368 TCTCACTGTCAAGGAGCCAATGG - Intronic
1076312290 10:129517188-129517210 CCTCGCTGTCCAGGAGCCATGGG - Intronic
1076460994 10:130647372-130647394 CCTCGCTGCCCAGGGAACATTGG + Intergenic
1076658446 10:132039481-132039503 CCACGCTGTCCAGGGGCCATGGG - Intergenic
1076688392 10:132208391-132208413 CCTGACTGTGCAGGTGCCATAGG + Intronic
1077170384 11:1163488-1163510 CCTGGGTGTCCAGCAGCCCTTGG + Intronic
1077254196 11:1573144-1573166 CCTCGCTGTCCTGGAGGAAGGGG + Intergenic
1079007797 11:16804336-16804358 CCTCTCTCTCCAGCAGCTATCGG - Intronic
1083302213 11:61745194-61745216 CCTGGGTGCCCAGGACCCATGGG - Exonic
1084088190 11:66864386-66864408 CCTCGCTGTCTGGGAGCCCACGG - Intronic
1084331799 11:68434773-68434795 CCTCGCTCTCCCAGAGCCACCGG + Intronic
1084358461 11:68654304-68654326 CCAGGCTGTCCAGGTGCCATTGG - Intergenic
1089398879 11:118153073-118153095 CCTCGCGGTCCCGGAGCCCCGGG + Intergenic
1090536158 11:127643988-127644010 CCTCTCTTTCCAGAAGCCACAGG + Intergenic
1091296014 11:134474479-134474501 CCTCGCGGGCCAGAAGACATGGG - Intergenic
1093628217 12:21376807-21376829 ACTCAATGTCCAGGAGCCAGTGG - Intronic
1100825457 12:98470723-98470745 CCTCTCTGTCCAGAAGACAGTGG + Intergenic
1101427416 12:104599358-104599380 CCGCGCGGTCCCGGAGCCATGGG + Intronic
1102085959 12:110139948-110139970 CCTAGCTGTCCAGGAGCCTGAGG + Intronic
1102221171 12:111195435-111195457 CCCCGCTGGCCGGGACCCATGGG - Intronic
1104729584 12:131097624-131097646 TCGTGCTGTCCAGGAGCCAAGGG + Intronic
1106261106 13:28067472-28067494 CCAGGCTGACCAGGAGCCAAGGG + Intronic
1107192172 13:37602255-37602277 CCTAGCTGTCCAGGAAGCCTGGG - Intergenic
1108940623 13:55948326-55948348 TCTCCCAGTCCAGGAGGCATGGG - Intergenic
1112199972 13:97264908-97264930 CCTGGATGTCCAGGAACCAATGG - Intronic
1118697752 14:68401355-68401377 TCTCCCTGTCCATGAGCCAGTGG + Intronic
1118740547 14:68736708-68736730 CCTCACTGTCCAGGGCCCAGCGG - Intergenic
1119704997 14:76777882-76777904 CCTCTCCTTCCAGGAGCCACAGG - Intronic
1121701192 14:95955364-95955386 CCTCATGGTCAAGGAGCCATTGG - Intergenic
1122430005 14:101634670-101634692 CCTCTGTATCCAGGAACCATCGG - Intergenic
1123806389 15:23877951-23877973 CCTCCCTTTCCGGGAGCCTTGGG - Intergenic
1124197448 15:27644779-27644801 CTTCTCTGTCCAGGAGGCAGTGG + Intergenic
1124355691 15:28993247-28993269 GCCCTCTGTCCAGGAGACATAGG + Intronic
1128599670 15:68985335-68985357 CCTCTCTGCCCAGGATCCATAGG + Intronic
1132855857 16:2044272-2044294 CCTCACCCTCCAGGAGCCCTGGG - Intronic
1133569308 16:7025725-7025747 CCTAGCTGAGCAGGAGCCATGGG + Intronic
1136152963 16:28364467-28364489 GCTCGCGGGCCAGGAACCATGGG + Intergenic
1136172562 16:28497611-28497633 CCTCGCTGTCTGGGAGCCCGCGG - Exonic
1136210120 16:28750806-28750828 GCTCGCGGGCCAGGAACCATGGG - Intergenic
1137038305 16:35586575-35586597 CCTCGAAGTTCAGGAGCCCTGGG - Intergenic
1137598250 16:49738891-49738913 CCCAACTGTACAGGAGCCATCGG + Intronic
1140990974 16:80211034-80211056 CCTTTCTGTCATGGAGCCATTGG - Intergenic
1143901316 17:10176766-10176788 CCTTGTTCTCCAGGAGCCAGTGG + Intronic
1144971046 17:19110164-19110186 CCTCCCTGTACAGGAACCAGGGG - Intergenic
1144991348 17:19236327-19236349 CCTCCCTGTACAGGAACCAGGGG - Intronic
1145826677 17:27882388-27882410 CCTCTCTGTCCAGGAAACAGAGG - Intronic
1146483766 17:33227116-33227138 CCTCGCTGCCAAGCAGCCACTGG - Intronic
1150218509 17:63483215-63483237 CCTGGCTGTCCAGGAGGCTGGGG - Intergenic
1151967850 17:77440952-77440974 TCTCCCTGTCCAGGAGCTACAGG - Intronic
1152781758 17:82229940-82229962 CCTCTCTGTCCCAGAGGCATGGG + Intronic
1155801925 18:30116472-30116494 CCTGGCTCTCCAGGAGACACTGG + Intergenic
1161216506 19:3097364-3097386 CAACGCTGTACGGGAGCCATGGG - Intronic
1161250973 19:3280127-3280149 CATGGCTGTCCAGGTGCCACAGG - Intronic
1162933737 19:13970151-13970173 CATAGTTGTCCAGGAGCCACTGG + Exonic
1165256491 19:34579665-34579687 ACTCCCTGTCCAGGAGCTCTAGG - Intergenic
1167246449 19:48375951-48375973 GCTCACTGCCCAGGAGCCCTAGG - Intronic
1167260007 19:48452962-48452984 CCGTGCTGACCAGGAGCCCTGGG - Exonic
926205259 2:10830997-10831019 CCTCACTGTCCCTGAGCCACAGG + Intronic
930634527 2:53789509-53789531 CCTCGCTGTTCAGGAGGCTGAGG - Intronic
932938985 2:76139732-76139754 ACTCGCTTTCCAGGTGCCACTGG + Intergenic
934653082 2:96103461-96103483 CCTAGCTGTCCCGCAGCCATCGG - Intergenic
936401123 2:112165133-112165155 CTCCCCTGTCCAGGTGCCATTGG - Exonic
936510409 2:113140752-113140774 CCTCTCTGATAAGGAGCCATGGG - Intergenic
941786884 2:169506752-169506774 CATGCCTGGCCAGGAGCCATGGG - Intronic
942089066 2:172471176-172471198 CCTAGAAGTCCAGGGGCCATAGG - Intronic
944178773 2:196863691-196863713 CCTAGCTGTCCAGGAGACTGAGG - Intronic
947391319 2:229642556-229642578 CCTCTCTGGTCAGGAGCCAGAGG - Intronic
947804880 2:232959528-232959550 CCATGCTGTACATGAGCCATTGG + Intronic
948701606 2:239764166-239764188 CCTCTGTGCCCAGGATCCATGGG - Intronic
948942422 2:241203102-241203124 CCTCGAAGTCCAGGAGTCAGAGG + Intronic
949012736 2:241690593-241690615 ACTGTCTGTCCAGGAGCAATGGG + Intergenic
1171445035 20:25196750-25196772 ACCCGCTGTGCAAGAGCCATGGG + Intronic
1172176629 20:32976422-32976444 CCTCACTGTCCCTGTGCCATAGG + Intergenic
1172275798 20:33678396-33678418 CCCCTCTGGCCAGGAGCCCTGGG + Intronic
1173254825 20:41386903-41386925 CCTGGCTGTCCAGGAACCCAGGG - Intergenic
1174057849 20:47810735-47810757 CTCCGCTGTCCTGCAGCCATGGG + Intergenic
1175761024 20:61562238-61562260 CCTCTCTCTCCGGGAGCCCTGGG - Intronic
1175761068 20:61562380-61562402 CCTCTCTCTCCGGGAGCCCTGGG - Intronic
1183533871 22:38383351-38383373 CTTTGCTGTCCATGAGACATAGG + Intronic
1184608792 22:45589685-45589707 CTTCTCTCTCCTGGAGCCATGGG - Intronic
1184887658 22:47356250-47356272 CCTGCAGGTCCAGGAGCCATGGG - Intergenic
950406604 3:12808939-12808961 CAGGGCTGGCCAGGAGCCATGGG + Intronic
950621507 3:14209436-14209458 CCTCCCTGTAGAGGAGGCATAGG - Intergenic
950663839 3:14482964-14482986 CCTTACTGTCCAGAAGCCAAAGG + Intronic
954288593 3:49636918-49636940 CCTTGTTGTCCAGGGGGCATGGG + Intronic
954381653 3:50222035-50222057 CCCCACTGCCCAGGAGCCAAGGG - Intergenic
959527979 3:107398805-107398827 CCTCACTCTCCAGAAGCCCTTGG + Intergenic
967343572 3:188427932-188427954 CCTGGCATTCCAGGAGCCACTGG + Intronic
968114895 3:196081943-196081965 CGGTGCTGTCCAGCAGCCATAGG - Intronic
969427820 4:7136069-7136091 CCTGGCTGTCTGGGGGCCATGGG + Intergenic
969486561 4:7475460-7475482 CCTCCCTGTGCAGCAGCCACAGG + Intronic
969703117 4:8778580-8778602 CCTCTCTGACCAGGGGCCACAGG + Intergenic
969898052 4:10323232-10323254 CATAGCTGTCCAGGTTCCATCGG - Intergenic
972952661 4:44347442-44347464 CCCCACTGACCAGTAGCCATTGG - Intronic
973917799 4:55654353-55654375 CATTGCTGTCCAGGGGTCATCGG - Intergenic
978338129 4:107691593-107691615 CCCAGCTGTCAAGGAGCCAGTGG + Intronic
985327223 4:188785019-188785041 TCTCGCTGTGCAGGGGCCAAGGG - Intergenic
987312520 5:16694469-16694491 CCACGCTGTCCAGGAGAAATTGG - Exonic
997292951 5:132750519-132750541 CCAAGCTTTCCAGGAGCCATGGG - Intronic
997639562 5:135439736-135439758 TCTCGGTGTCCAGGAGGCCTTGG + Intergenic
999777104 5:154820274-154820296 CCTGGCTGTCCCTCAGCCATGGG - Exonic
999826537 5:155278749-155278771 CTTTGCTGTCCAGGAGACAGAGG + Intergenic
1002052863 5:176581456-176581478 CCTCTCTGTCCAGGGGCCCCAGG - Exonic
1003650486 6:7955106-7955128 CCTTGCTGTCCAGCAACAATGGG - Intronic
1005825797 6:29631415-29631437 CATATCTGTCCAGGAGCCGTTGG + Exonic
1006931673 6:37692528-37692550 CCCAGCTGCCCAGGAGGCATGGG - Intronic
1007336247 6:41157140-41157162 GCTCCCTGTCCTGGAGCCTTGGG - Intergenic
1008466615 6:51838376-51838398 CCACTCAGTCCAGAAGCCATTGG - Intronic
1010449402 6:75985978-75986000 CCTCACAGGCCAGGAACCATGGG + Intronic
1016192446 6:141287601-141287623 CCTTGCAGGCCAGGAGACATAGG - Intergenic
1016307228 6:142696865-142696887 CCTCTCTGTCCAGCTGCCACTGG + Intergenic
1019071930 6:169353875-169353897 GCTGGCTTTCCAGGAGCCACTGG + Intergenic
1019310785 7:359700-359722 CCTGGCTGTCCAGGGGTCCTGGG - Intergenic
1019316407 7:388938-388960 CATCGCTGTCCTGAAGCCAAAGG - Intergenic
1022127970 7:27376296-27376318 CCTCACATTCCACGAGCCATTGG + Intergenic
1022811064 7:33869491-33869513 CCTCTGTGTCCAGGACCCAGTGG - Intergenic
1024338869 7:48237217-48237239 CCTTGCTGCTCAGGAGTCATGGG - Intronic
1024990780 7:55233335-55233357 CCTCGGTCTCCAGGTGCCATGGG - Intronic
1025267316 7:57474425-57474447 CATCACAGACCAGGAGCCATAGG + Intergenic
1025740513 7:64192319-64192341 CCTCGCTCTCCAGGAGCTCCGGG - Intronic
1033733725 7:144202171-144202193 CATTTGTGTCCAGGAGCCATGGG + Intergenic
1033749325 7:144348802-144348824 CATTTGTGTCCAGGAGCCATGGG - Intergenic
1035075473 7:156174717-156174739 CCACGCTGTCCTGGAGGCAGTGG + Intergenic
1038450902 8:27638127-27638149 CCTCGCTCTCGATGAGCCTTGGG - Intronic
1044016235 8:87051324-87051346 CCTCACTATCCAGGAGCCCTGGG - Intronic
1052850194 9:33373518-33373540 CCTGGCTATCCTTGAGCCATGGG - Intergenic
1058109682 9:101018538-101018560 CCCCGCAGTGCAGGAGCCCTTGG + Intergenic
1059755703 9:117291370-117291392 CCCCACTCTCCAGGAGCCCTCGG - Exonic
1062364975 9:136204141-136204163 GCTCACAGTCCAGAAGCCATAGG - Intronic
1062379319 9:136279550-136279572 CGTGGCTGTCCTGCAGCCATTGG + Intergenic
1062436922 9:136550500-136550522 CCTTGCTGCCCATGAGGCATGGG + Intergenic
1062496932 9:136836361-136836383 CCTAGCTGTACAGGAGCCTGAGG - Intronic
1062579054 9:137221621-137221643 GCGCCCTGTCCTGGAGCCATGGG - Intergenic
1062730013 9:138103466-138103488 CCTCGGGGCCCAGGAGTCATGGG + Intronic
1190002956 X:46707170-46707192 TCTAGCTGGCGAGGAGCCATTGG - Intronic
1200000043 X:153055766-153055788 CTTCGCTGCCCAGGTGCCAGTGG - Intergenic
1201058903 Y:10024642-10024664 ACTGGCTTTGCAGGAGCCATGGG - Intergenic