ID: 1076312789

View in Genome Browser
Species Human (GRCh38)
Location 10:129520610-129520632
Sequence GGTTCTGTAGGTGCACCTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 60}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076312789_1076312798 28 Left 1076312789 10:129520610-129520632 CCCTAAGGTGCACCTACAGAACC 0: 1
1: 0
2: 1
3: 5
4: 60
Right 1076312798 10:129520661-129520683 GTGTATGTGCAGAGCCCCTACGG No data
1076312789_1076312792 -10 Left 1076312789 10:129520610-129520632 CCCTAAGGTGCACCTACAGAACC 0: 1
1: 0
2: 1
3: 5
4: 60
Right 1076312792 10:129520623-129520645 CTACAGAACCCCTAAAGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076312789 Original CRISPR GGTTCTGTAGGTGCACCTTA GGG (reversed) Intronic
913181985 1:116330958-116330980 GGTCCTGTAGGTCCTGCTTATGG + Intergenic
916020707 1:160789840-160789862 AGTTCTGCAGGTGCACTTTATGG - Intergenic
919013562 1:191997622-191997644 GCTTCTCTAGGAGCACCTAATGG + Intergenic
1066668437 10:37811359-37811381 GAGTCTGTAGGTGTGCCTTATGG - Intronic
1069587970 10:69621141-69621163 GGCTCTGTAGCTGCACCCTTGGG + Intergenic
1071813284 10:89206803-89206825 AGTTCTGGTGGTGCACCTTGTGG + Exonic
1072412728 10:95218731-95218753 GGTTCTGTAGATCCACTTTTTGG - Intronic
1074923114 10:118038417-118038439 GGTTCTGTAGGTATACCCAAGGG - Intronic
1076312789 10:129520610-129520632 GGTTCTGTAGGTGCACCTTAGGG - Intronic
1076312802 10:129520676-129520698 GGTTCTGTACCCGCACCGTAGGG - Intronic
1076312815 10:129520720-129520742 GGTTCTGTACCCGCACCATAGGG - Intronic
1076312825 10:129520764-129520786 GGCTCTGCAGGCACACCTTAGGG - Intronic
1076312838 10:129520808-129520830 GGTTCTGTACCCGCACCGTAGGG - Intronic
1076312842 10:129520830-129520852 GGGTCTGTACATGCACCATAGGG - Intronic
1076312857 10:129520896-129520918 GGTTCTGTATGCACACCATAGGG - Intronic
1076312867 10:129520940-129520962 GGCTCTGTAGGCACACCTTAGGG - Intronic
1080485671 11:32704456-32704478 GCTTCTGAAGGTGAAACTTAGGG + Intronic
1085424635 11:76393269-76393291 GTTCCTGTAGGCTCACCTTAGGG + Intronic
1089751885 11:120657568-120657590 GGATCAGTATGTGCTCCTTAAGG - Intronic
1090325459 11:125882577-125882599 GGTTCTGTAGGTCTAACTTTAGG + Intergenic
1093375012 12:18415378-18415400 TGTACTGTGGGTGCACCTTGTGG - Intronic
1098688652 12:73458291-73458313 GGTTATTTCTGTGCACCTTACGG + Intergenic
1112096326 13:96136105-96136127 TGTATTGTAGGTGCACCTGACGG - Intronic
1114534156 14:23412477-23412499 GGTGCTCTAGGTGAACTTTAGGG + Intergenic
1117369426 14:55062984-55063006 GGATCTGTGGGTGCACCATATGG - Exonic
1118632451 14:67718181-67718203 GGTGCTGTACGGGCTCCTTAGGG + Intronic
1121467897 14:94127830-94127852 GGTTTTGGAGGTTCACCTTGGGG + Exonic
1125455264 15:39852223-39852245 GGTAGTGTAGGTGCACTCTAAGG - Intronic
1135289366 16:21222098-21222120 GTTTCTGTATGTGCACATCAAGG - Intergenic
1138337953 16:56267640-56267662 TGTACTGTAGGTGCTCCTTCAGG + Intronic
1140951280 16:79820294-79820316 GGTGATTTAGGTGCACATTAAGG - Intergenic
1148091336 17:45024164-45024186 TGTTCTGTAGGTGCTGCTCAGGG + Exonic
1153487593 18:5615931-5615953 GGTTCTGGAGGAGAACCTGAGGG - Intronic
1156334279 18:36154369-36154391 GGTTCTGCATGTGGACCTGATGG - Intronic
1161041685 19:2113814-2113836 GGTTCTGGAGCTGCACGTGAGGG + Intronic
936022256 2:109003756-109003778 GCTGCTGGAGTTGCACCTTAAGG - Intergenic
942504981 2:176632403-176632425 GGTTCTGTATGGGCACCTACCGG - Intergenic
944509104 2:200446673-200446695 GGTTCTGCTGGAGCACCTTGAGG + Intronic
946285317 2:218698225-218698247 GGTTCTGTTGGTGCTCATTGGGG + Intronic
947364143 2:229376638-229376660 GGTAGTGTGGGTGCACCTTCAGG + Intronic
1177877128 21:26647010-26647032 GGTTTGGTAGGTGCTCCTTTTGG + Intergenic
1179189253 21:39108914-39108936 GGTTCTGTAGCAGCTTCTTATGG - Intergenic
1179509208 21:41861311-41861333 GTTTCTGGAGGTGAACCTCAAGG - Intronic
1179585178 21:42370144-42370166 GGTTCTGTAGGTGGCCCTGGAGG + Intergenic
1182808700 22:33097444-33097466 GGTGTTGGATGTGCACCTTACGG - Intergenic
1183665908 22:39245508-39245530 GGTTCTGTGGGTTCACCTTGCGG - Intergenic
1184721970 22:46320037-46320059 GGTTCTGCAGGGACACCCTACGG + Intronic
962711780 3:138092782-138092804 GGTTCAGTAGTTGCTTCTTATGG - Intronic
970928315 4:21479039-21479061 GGTTCAGTAGGTGAACTTTAAGG + Intronic
975555239 4:75656869-75656891 GGTTCTGTTGGTACTCTTTATGG - Intronic
983481032 4:168274186-168274208 GGATCTGTAGGTACATCTGAAGG + Intronic
985429883 4:189869070-189869092 GGTGCTGTAGGAGCACATTGGGG - Intergenic
996441994 5:123501949-123501971 GGTTATGGAGGGGCACCTCAAGG - Intergenic
999113309 5:149140939-149140961 GGGCCTGTAGGTGAACCCTACGG + Intergenic
1013637020 6:112038582-112038604 GGTACTGTAGGGGCCCCTGAAGG - Intergenic
1017551582 6:155515247-155515269 GTTTCTAGAGGTGCAACTTACGG + Intergenic
1030064318 7:105647731-105647753 GGCTCTGAATGTGCTCCTTAAGG + Intronic
1034192778 7:149224383-149224405 GGTTCTGCAGGTGCTCCTTACGG - Exonic
1041694112 8:60717534-60717556 GGTTATGTAGTTAAACCTTATGG + Intronic
1041758585 8:61339529-61339551 GGTTCTGTCAGTGCCCCATAAGG - Intronic
1050398785 9:5229101-5229123 GTTTCAGTAGGTGCACACTAAGG - Intergenic
1052038433 9:23709489-23709511 GATTCTGTAGGTGCATATGAAGG - Intronic
1054810304 9:69429019-69429041 GGTTATGTATGTTCACCTAAAGG - Exonic
1185431353 X:13676-13698 GGGTCTGTGGGTGGTCCTTAGGG - Intergenic
1185440591 X:226007-226029 GGGTCTGTGGGTGGTCCTTAGGG - Intergenic
1185440643 X:226137-226159 GGGTCTGTGGGTGGTCCTTAGGG - Intergenic
1186161015 X:6777231-6777253 GTTTCTGTACCTACACCTTAAGG + Intergenic