ID: 1076316909

View in Genome Browser
Species Human (GRCh38)
Location 10:129548722-129548744
Sequence CAGTCCCACCTGCAGCTTTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076316903_1076316909 12 Left 1076316903 10:129548687-129548709 CCGTGCAGGGTGCTGGGGGCAGT 0: 1
1: 0
2: 5
3: 61
4: 446
Right 1076316909 10:129548722-129548744 CAGTCCCACCTGCAGCTTTCGGG No data
1076316898_1076316909 20 Left 1076316898 10:129548679-129548701 CCTGTGGGCCGTGCAGGGTGCTG 0: 1
1: 0
2: 1
3: 22
4: 258
Right 1076316909 10:129548722-129548744 CAGTCCCACCTGCAGCTTTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076316909 Original CRISPR CAGTCCCACCTGCAGCTTTC GGG Intronic
No off target data available for this crispr