ID: 1076320764

View in Genome Browser
Species Human (GRCh38)
Location 10:129579935-129579957
Sequence CACCCAGGCCTGCCCGTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076320755_1076320764 15 Left 1076320755 10:129579897-129579919 CCCTTGACACTTTCTGGTCCCAG 0: 1
1: 0
2: 0
3: 19
4: 172
Right 1076320764 10:129579935-129579957 CACCCAGGCCTGCCCGTGAGAGG No data
1076320760_1076320764 -4 Left 1076320760 10:129579916-129579938 CCAGAGAGGGCACCGCAGCCACC 0: 1
1: 0
2: 0
3: 24
4: 209
Right 1076320764 10:129579935-129579957 CACCCAGGCCTGCCCGTGAGAGG No data
1076320759_1076320764 -3 Left 1076320759 10:129579915-129579937 CCCAGAGAGGGCACCGCAGCCAC 0: 1
1: 0
2: 0
3: 16
4: 180
Right 1076320764 10:129579935-129579957 CACCCAGGCCTGCCCGTGAGAGG No data
1076320756_1076320764 14 Left 1076320756 10:129579898-129579920 CCTTGACACTTTCTGGTCCCAGA 0: 1
1: 0
2: 1
3: 22
4: 188
Right 1076320764 10:129579935-129579957 CACCCAGGCCTGCCCGTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076320764 Original CRISPR CACCCAGGCCTGCCCGTGAG AGG Intronic
No off target data available for this crispr