ID: 1076321828

View in Genome Browser
Species Human (GRCh38)
Location 10:129588729-129588751
Sequence ACCCTGTGATGTCAGTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076321828_1076321831 23 Left 1076321828 10:129588729-129588751 CCAGCACACTGACATCACAGGGT No data
Right 1076321831 10:129588775-129588797 CAGCATCATGCAAACTGCCTAGG No data
1076321828_1076321829 -8 Left 1076321828 10:129588729-129588751 CCAGCACACTGACATCACAGGGT No data
Right 1076321829 10:129588744-129588766 CACAGGGTGCCTGCAGCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076321828 Original CRISPR ACCCTGTGATGTCAGTGTGC TGG (reversed) Intronic
No off target data available for this crispr