ID: 1076322351

View in Genome Browser
Species Human (GRCh38)
Location 10:129592729-129592751
Sequence CTGGCTTAACAGAAGGCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 488
Summary {0: 1, 1: 2, 2: 15, 3: 84, 4: 386}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076322351 Original CRISPR CTGGCTTAACAGAAGGCAGG TGG (reversed) Intronic
900197097 1:1381981-1382003 CTGGCTTAGGAGAGGGCACGTGG - Intergenic
900345824 1:2209838-2209860 CTGTCTGGACAGAAGGCAGGAGG - Intronic
902310548 1:15578593-15578615 CTGGCTTAGAAGAGGGGAGGAGG - Intronic
903513990 1:23897816-23897838 CTGGTTTATGAGAAGGCAGCTGG + Intronic
903963171 1:27070172-27070194 TTGGGTGAACTGAAGGCAGGTGG + Intergenic
904197805 1:28798986-28799008 CTGTCTTAACAGATGGCAGCAGG - Intergenic
905025200 1:34845015-34845037 CTGGCTGGGCAGAAGGCAGCAGG + Intronic
905265149 1:36747818-36747840 CTGGCATCATAGAAGGCAGTTGG + Intergenic
905957083 1:42006635-42006657 CTGGCTTAATAGAAGACAACTGG + Intronic
905986534 1:42288796-42288818 CTGACTTAATAGAAGACAGCTGG - Intronic
906222359 1:44091274-44091296 CTGGCTAAACAGAAGACAGCTGG + Intergenic
906236533 1:44214551-44214573 CTTGCTTAGCAGGATGCAGGAGG + Intronic
907087895 1:51694321-51694343 CTGACTTAATAGAAGACAGCTGG + Intronic
909709062 1:78623616-78623638 CTGGCTTTACATCTGGCAGGTGG - Intronic
910200365 1:84692036-84692058 CTTGCTTAATAGAAGGCATTTGG + Intergenic
910420519 1:87057063-87057085 CTGGCTTAATAGAAGACAACTGG - Intronic
910888311 1:91989921-91989943 ATGGCTTTTCAGAAGGCAGAAGG + Intronic
911488700 1:98535240-98535262 CTAGCTTAATAGAAGGTAGCTGG + Intergenic
911593040 1:99769636-99769658 CTGGCTTAATAGAAGACAGTAGG + Intergenic
912331664 1:108825936-108825958 CTGGCTTAATAAAAGGCAACTGG + Intronic
912571649 1:110628686-110628708 ATGACTTGAAAGAAGGCAGGAGG + Intronic
912582714 1:110734873-110734895 TTGGCTTAACAAAGGGCAAGTGG + Intergenic
912690405 1:111800733-111800755 CTGGCTCATCACTAGGCAGGGGG - Intronic
913496127 1:119429904-119429926 CTTGCTCAACAGAAGGCAGTCGG - Intergenic
915155032 1:153868376-153868398 CTGGCTTAATAGCAGACAGCTGG + Intronic
915469928 1:156119749-156119771 GTGGCTTTACAGAAGACAGCAGG + Intronic
915768241 1:158388987-158389009 CTGGCTGAACAGAAGAAAGTTGG + Intergenic
915856649 1:159395834-159395856 CTGGTTTAATAGAAGACAGCTGG - Intergenic
916157903 1:161875098-161875120 CTGGCTTAATAGAAACCAGCTGG + Intronic
917085015 1:171296520-171296542 CTCACTTAACAGAAGGCAGTTGG - Intergenic
917657985 1:177146181-177146203 CTGGCTTAATAGAAGACAGATGG + Intronic
918507810 1:185277111-185277133 CTGGCTTAATAGAAGGCAGTGGG + Intronic
918674858 1:187270719-187270741 CTGGCTTAGCAGTAATCAGGAGG - Intergenic
919437896 1:197586228-197586250 CTGGCTTAATAGAAGTCAGCTGG - Intronic
919908539 1:202095401-202095423 CTGGCTTAATAGAAGACAGCTGG - Intergenic
919962087 1:202481443-202481465 TTGGCTTAATAGAAGACAGTGGG - Intronic
920606709 1:207396065-207396087 GTGGCCTGTCAGAAGGCAGGTGG + Intergenic
922471592 1:225880423-225880445 CAGGCTGAGGAGAAGGCAGGGGG + Intronic
923110284 1:230884771-230884793 CTGGCTAAGCAGAAGACCGGGGG - Intergenic
923806028 1:237258956-237258978 CTGGCCAAGCAGAAGGCAGAAGG - Intronic
1062973940 10:1669369-1669391 CTGCTTTCACACAAGGCAGGTGG - Intronic
1063421890 10:5919063-5919085 CTGGCATAACAGAAGACTGCTGG - Intronic
1064405998 10:15063876-15063898 CTGACATAATAGAAGGCAGATGG + Intronic
1065401795 10:25311950-25311972 CTGGCCTAATAGAAGACAGATGG + Intronic
1065564938 10:26998824-26998846 CTCACTCAACAGAAGGCAGCTGG - Intronic
1066200264 10:33137496-33137518 CTGGCTTGAGGGAAGGAAGGGGG - Intergenic
1068138352 10:52973444-52973466 CATGCTTCACAGAAGGAAGGGGG - Intergenic
1068802669 10:61160041-61160063 CTGGCATAACAGAATGAGGGTGG - Intergenic
1068911653 10:62384536-62384558 GTGGCTTCATAGAAGGCAGCTGG + Intronic
1069409386 10:68137226-68137248 CTGGCTTAATGGAAGACAGCTGG + Intronic
1069713335 10:70504696-70504718 CTGGCTTAACAGAAGACAGCTGG + Intronic
1070970437 10:80561954-80561976 CCAGCTTAATAGAAAGCAGGTGG - Intronic
1071513469 10:86281921-86281943 CAGACCTTACAGAAGGCAGGAGG - Intronic
1071684498 10:87740794-87740816 CTGACTTAATAGAAGACAGCTGG - Intronic
1072005512 10:91242659-91242681 CTGGGTGAACAGAATGCAAGTGG - Intronic
1072392043 10:94997369-94997391 CTGCCTGTAAAGAAGGCAGGTGG - Intergenic
1072846306 10:98834799-98834821 CTGGCCTAATAGAAGACAGCTGG - Intronic
1073014722 10:100388851-100388873 CTGACTTAATAGAAGACAGCTGG - Intergenic
1073105560 10:101030558-101030580 CTGACTTTATACAAGGCAGGTGG + Intronic
1073571925 10:104588009-104588031 CTGGCTTAATAGAAGTCAATTGG - Intergenic
1074518089 10:114190158-114190180 TTGGCTTAACAGAAGACAGCTGG - Intronic
1074957016 10:118401152-118401174 CTAGCTTAATAGAAGGCAGCTGG + Intergenic
1074991715 10:118714115-118714137 CTAGCTTAATAGAAGACAGCTGG + Intronic
1075260463 10:120959016-120959038 CTGGGTGAACAGAAGACAGGTGG - Intergenic
1075388837 10:122077652-122077674 CTGGCAGAACAGAATGAAGGGGG + Intronic
1076322351 10:129592729-129592751 CTGGCTTAACAGAAGGCAGGTGG - Intronic
1080638541 11:34144441-34144463 CTGGCTTAACAGAAGGCAGCCGG + Intronic
1080797379 11:35577539-35577561 CTGGCTTAAAAGGAGTCAGCTGG - Intergenic
1080885979 11:36368690-36368712 CTGGCTTAATAGAAGACAGTTGG - Intronic
1080892319 11:36419721-36419743 CTGGCTTCATAGAAGACAGTTGG + Intronic
1080914408 11:36641171-36641193 CTGGCTGAACAGAAGAAAGTTGG - Intronic
1081699315 11:45142809-45142831 CTGGCTTAACATGAGGCCTGTGG + Intronic
1081865843 11:46360138-46360160 CTGGCCTAATAGAAGGCAGCTGG - Intronic
1082225893 11:49706342-49706364 CTGGGTTAATGGAAGGCAGTAGG - Intergenic
1083257816 11:61507489-61507511 CGGGTTCAAGAGAAGGCAGGAGG + Intergenic
1084328590 11:68416334-68416356 CTGGCTGAACAGCAAGAAGGTGG - Exonic
1085377049 11:76073941-76073963 CTAGCTTAATAGAAGCCAGCTGG - Intronic
1085798355 11:79564446-79564468 CTGGCTGAGCAGATGGCAGTAGG + Intergenic
1085816465 11:79742393-79742415 CTGGCTTCACAGAGGGGAAGGGG - Intergenic
1086297532 11:85387691-85387713 CTGGCTTGACAGAAAGTAAGAGG - Intronic
1087310672 11:96538507-96538529 CTGGCATATCAGAGAGCAGGAGG - Intergenic
1087857174 11:103106375-103106397 CTGCCTTAACAGAAGACAACTGG - Intergenic
1088410851 11:109532839-109532861 CTGGCTTAACAGCACTCAGGAGG - Intergenic
1088530611 11:110804381-110804403 CTGGCTTAAAAGAAGGCAGCTGG - Intergenic
1088549184 11:110993274-110993296 CTGGTTTTATAGAAGACAGGTGG + Intergenic
1089486464 11:118850325-118850347 CTGGCTTCACAGAAGACAGCTGG + Intergenic
1089562070 11:119348438-119348460 CTGGCTTAATAGAAGGCAGCTGG - Intergenic
1090653080 11:128823998-128824020 CTGGATTCACAGACGGCTGGAGG - Intergenic
1090783927 11:130031656-130031678 CTTTCTTAAAAGAAAGCAGGTGG - Intergenic
1092123760 12:6061896-6061918 CTGGCTTAATAGGAGACAGCTGG - Intronic
1093930045 12:24947048-24947070 CTGGCCTAACAAAAGGGTGGTGG - Intronic
1093950258 12:25157461-25157483 CTGACTTAACAGAAGACAGCTGG - Intronic
1094278945 12:28712895-28712917 CTGGCTTGATAGAAGACAGATGG + Intergenic
1094286757 12:28802868-28802890 CTGGCTTAATAGGAGACAGCTGG + Intergenic
1096218353 12:49810676-49810698 CTGACTTAATAGAAGGAAGCTGG - Intronic
1096269629 12:50154546-50154568 CTGGCTTAATAGAAGACAGCTGG - Intronic
1096502588 12:52073934-52073956 GTGGCATAGCAGATGGCAGGGGG + Intronic
1096604432 12:52754514-52754536 CTGGCTTCTCAGGAGGCAGCAGG + Intergenic
1096635973 12:52959850-52959872 CTGGCTTTAAAGATGGCAGATGG - Intergenic
1097669577 12:62519620-62519642 CTGGCTTAATAGGAGACAGCTGG + Intronic
1100777831 12:97991733-97991755 ATGGCAGAAAAGAAGGCAGGAGG - Intergenic
1102011441 12:109621643-109621665 CTGGCTTAATAGAACACAGCTGG - Intergenic
1102308580 12:111825884-111825906 CTGGCATATCCGATGGCAGGAGG - Intergenic
1104301001 12:127565077-127565099 TCGGCTTCACAGCAGGCAGGTGG + Intergenic
1105303077 13:19152341-19152363 CTGTCTTCAGAGAAGGCTGGGGG - Intergenic
1106875395 13:34066559-34066581 CTGGCTTCAAAGCAGGCAGGGGG - Intergenic
1107986728 13:45782599-45782621 CTTGCTCAACAGAAGGCAAAGGG + Exonic
1109130293 13:58575871-58575893 CAGGCTTAACAGGAAGCATGAGG + Intergenic
1110013592 13:70370644-70370666 CTGGCTTAATACAAGACAGCTGG + Intergenic
1110166688 13:72450544-72450566 CTGGCTTAATAGAAAGCACCTGG - Intergenic
1111538656 13:89640202-89640224 CTGGTTTAATAGAAGGCAACTGG - Intergenic
1113136136 13:107091543-107091565 CTGGCTTAATGGAAGACAGCTGG + Intergenic
1113246633 13:108403685-108403707 CTGGCTAAATAGAGAGCAGGTGG + Intergenic
1114404798 14:22446347-22446369 CTGGCATATCAGAAGACAGTTGG + Intergenic
1114415439 14:22539889-22539911 CTTCCTTCACAGAATGCAGGAGG - Intergenic
1116412361 14:44639722-44639744 CTGCCTAAACAGGAGGCAAGGGG - Intergenic
1116873960 14:50093082-50093104 CTGGACTAACAGAAGCCAGAGGG - Intergenic
1117094351 14:52282352-52282374 CTCACTCAACAGAAGGCAGTAGG + Intergenic
1118179524 14:63478498-63478520 CTGGCTTAATAGAAAGCAACTGG + Intronic
1118236556 14:64010439-64010461 CAGGCTTGACAGAAGGAAGACGG + Intronic
1118439509 14:65799862-65799884 CAGCCTCAACAGCAGGCAGGAGG + Intergenic
1118710667 14:68516409-68516431 CCGGCTTAATAGAAGACAGCTGG + Intronic
1118757672 14:68856783-68856805 CTGGCTTAATAGAAACCAGCTGG - Intergenic
1118778423 14:68989198-68989220 AGGGCTTTCCAGAAGGCAGGAGG - Intergenic
1119076321 14:71643598-71643620 CTGGCTTAATAGAAGGCACTTGG + Intronic
1119165314 14:72487614-72487636 CTGGCTTTGCAGATGGAAGGGGG + Intronic
1119790799 14:77348055-77348077 TTGGCTTAATAAAAGGCAGTTGG - Intronic
1121204545 14:92151693-92151715 CTAGCTCAACAGAAGACAGCTGG - Intronic
1121836935 14:97100922-97100944 CTGACTTATCAGAAGACAGTTGG + Intergenic
1122244421 14:100391959-100391981 CTGGCTTAATACAAGACAGCTGG - Intronic
1122676555 14:103419539-103419561 CTGGCTTAATAGAAGTTAGCTGG + Intronic
1123018766 14:105387795-105387817 CTGGCTCGGCAGAGGGCAGGTGG + Intronic
1124686185 15:31784398-31784420 CTGGCTTAATAGAAGACAGCTGG - Intronic
1124694379 15:31851709-31851731 CTGGCTTTAGAGAAGCCAGAAGG - Intronic
1124700750 15:31909886-31909908 CTGGGTACCCAGAAGGCAGGGGG + Intergenic
1124886416 15:33690965-33690987 CTGACTTAATTGAAGGCAGCTGG + Intronic
1124934131 15:34154066-34154088 CTGGTTTAACAAAAGACAGCTGG + Intronic
1125599094 15:40906056-40906078 CTGGCTTAGGAGAAGACAGAAGG - Intergenic
1125711822 15:41793081-41793103 CTGGCTTAACAGAAGGGAGCTGG - Intronic
1126437107 15:48646785-48646807 TTGGCTTGACAGCAGGCTGGTGG - Intergenic
1126532122 15:49722227-49722249 CTGGCTTAATAGAAGACAGCTGG + Intergenic
1126796477 15:52264054-52264076 CTGGTTTAACAGGAGGCAGGCGG - Intronic
1127545397 15:59989799-59989821 CTGGCTTAATAGAAGACAACTGG + Intergenic
1127669264 15:61179350-61179372 CTGGCTTAATAGAAAACAGCTGG - Intronic
1127757190 15:62104213-62104235 CTGGCTTAAAAGAGGGCTTGGGG - Intergenic
1128044695 15:64607413-64607435 CTGGTTTAATAGAAGACAGCTGG - Intronic
1128251654 15:66167982-66168004 CTGGCCTAGGAGAATGCAGGAGG - Intronic
1128558646 15:68649805-68649827 CTGGCTTATTAGAAGACAGCTGG + Intronic
1128619744 15:69138636-69138658 ATGAATTAACAGAAGGAAGGAGG + Intergenic
1128928882 15:71685556-71685578 CTGGCCTAATAGAAGACAGCTGG + Intronic
1129104893 15:73299757-73299779 CTGGCTTAATAGAAGACAGCTGG + Intronic
1129353855 15:74974380-74974402 CTGGCTTAATAGAAGACAGCTGG - Intronic
1130057668 15:80542225-80542247 CTGGCTTTACAGAAGTGAAGTGG - Intronic
1130350364 15:83085934-83085956 CTGGCTTAATAGGAGACAGCAGG - Intergenic
1130616382 15:85412407-85412429 CTGGCTTAATAGAAGACAGCTGG - Intronic
1130970247 15:88726614-88726636 AGGGCTTAGCAGATGGCAGGGGG + Intergenic
1131877332 15:96823886-96823908 CTGGCTTAGTAGAAGGCAACTGG + Intergenic
1131967352 15:97858539-97858561 CTGACAAAACAGAAGGCAGGAGG + Intergenic
1132075943 15:98819850-98819872 CTGGCTTAACAGAAGGCAATTGG + Intronic
1132283146 15:100637857-100637879 CTGGCTTCACAGAAGGCAGCTGG - Intronic
1134049772 16:11129397-11129419 CTGGCTTAATAGAAGACATCTGG + Intronic
1134241240 16:12508656-12508678 CAGGCTTAACAGAGGGCACCAGG - Intronic
1135716273 16:24771045-24771067 CTGGCTTAACAGAAGGTAGGTGG - Intronic
1137541450 16:49364968-49364990 CTGTCTCCACAGAAGGCAGCTGG - Intergenic
1137699121 16:50483475-50483497 CTGGCTTAATAGAAAACAGCTGG + Intergenic
1137888726 16:52135346-52135368 CTGGCTTAATAGAAGACACCTGG - Intergenic
1138040179 16:53655155-53655177 CTGGCTTAATAGAAAACAGCTGG - Intronic
1138216799 16:55211623-55211645 CTTTCTTAACAGAGGGCAGCTGG - Intergenic
1138555848 16:57770844-57770866 CTGGCTTTCCAGAAAGCTGGGGG + Intronic
1139469220 16:67169537-67169559 CTAACTGAGCAGAAGGCAGGCGG + Intronic
1139484914 16:67249951-67249973 CTGGCTGCTCAGAAGGGAGGAGG - Intronic
1140422940 16:74835725-74835747 CTGTCTCAAAAGGAGGCAGGAGG - Intergenic
1141268795 16:82520663-82520685 CTGGATTAAGAATAGGCAGGAGG - Intergenic
1141980438 16:87546977-87546999 CTAGCTTTCCAGCAGGCAGGGGG + Intergenic
1142902415 17:3020270-3020292 TTGGCTTAACACAGGGAAGGAGG + Intronic
1144191896 17:12854051-12854073 TTGGCAGAACAAAAGGCAGGTGG + Intronic
1144249715 17:13403486-13403508 CTGGGGTACCAGAAGGAAGGTGG - Intergenic
1144857727 17:18279103-18279125 CTGGCTTAATAGAAGAGAGCTGG - Intronic
1144888532 17:18479894-18479916 CTGGTTTTAAAGATGGCAGGAGG - Intronic
1145143674 17:20464408-20464430 CTGGTTTTAAAGATGGCAGGAGG + Intronic
1145225869 17:21127455-21127477 CCGGTTTTTCAGAAGGCAGGAGG + Intronic
1145792172 17:27634237-27634259 CTGGTTTTAAAGATGGCAGGAGG - Intronic
1145816265 17:27797211-27797233 GGGGCTTCACAGAAGTCAGGTGG - Intronic
1146553590 17:33803702-33803724 TTGTCTGAATAGAAGGCAGGCGG - Intronic
1148138555 17:45311737-45311759 GTGGCTGAAAAGGAGGCAGGTGG + Intronic
1149467374 17:56890785-56890807 CTGGATCAACAGAAGCCTGGTGG - Exonic
1150901652 17:69284688-69284710 CTGTCTTAACAGAAGACAGATGG + Intronic
1152041016 17:77903017-77903039 CCGGATTCACAGAATGCAGGCGG + Intergenic
1152285871 17:79413077-79413099 CTGGTTTAAAAGCAGGGAGGGGG + Intronic
1152333721 17:79688072-79688094 CTGGCTTGATAGAAGACAGCTGG - Intergenic
1152558559 17:81066744-81066766 CTGGCCTCACAGAGAGCAGGAGG - Intronic
1152640722 17:81448184-81448206 CTGGCAGAGCAGGAGGCAGGCGG - Intronic
1153282858 18:3430287-3430309 CTGGTTTAATAGAAGACAGTTGG - Intronic
1155139831 18:23034964-23034986 TTGGCTTAATAGAAGACAGTTGG - Intergenic
1155473148 18:26211708-26211730 CTGGCTTAGTAGAAGACAGCTGG - Intergenic
1156593392 18:38517762-38517784 CAGACTTAACAGAAAGCAGTAGG - Intergenic
1157190915 18:45580945-45580967 CAGGCTGAGCAGGAGGCAGGAGG + Intronic
1157300473 18:46475233-46475255 CTGGGTCACCAAAAGGCAGGAGG + Intergenic
1157623641 18:49030802-49030824 CTGCCTTAATAGAAGACAGCTGG + Intergenic
1157875274 18:51267448-51267470 CTGGCTTAATAGAAGACACCTGG - Intergenic
1159727190 18:71975857-71975879 GTTGCCTATCAGAAGGCAGGAGG - Intergenic
1160205174 18:76825550-76825572 CTCGATTAACAGAAGACAGTTGG - Intronic
1160247618 18:77171681-77171703 CTAGCTTAACAGGAGACAGCTGG + Intergenic
1161132618 19:2600328-2600350 CTGGCTTAATAGAAGACAGCTGG + Intronic
1162924993 19:13926431-13926453 CTGGGGGAAGAGAAGGCAGGCGG + Intronic
1163119609 19:15209329-15209351 CTGGCTTCTCAGAGGGCAGGAGG + Intergenic
1163150899 19:15413352-15413374 CTAGCTTAAGAGAAGTCACGTGG - Intronic
1165450676 19:35880350-35880372 CTGTCTTAAAAAAAGGGAGGTGG - Intergenic
1165895064 19:39136463-39136485 CTGACTGAACAGAAGGAAGGAGG - Intronic
1165920400 19:39294154-39294176 CTGCCTGGAGAGAAGGCAGGCGG - Intergenic
1166092442 19:40519035-40519057 CTGGTTTAAGAGATGGCAGCTGG + Intronic
1166505394 19:43368391-43368413 CTGGCTTAGGGGAAGGCAGAAGG - Intergenic
1166646113 19:44533019-44533041 CTGGCTTAGGAGAAGGTGGGTGG - Intergenic
1166796811 19:45431218-45431240 CAGGCTTAACAGAAGACAGCTGG - Intronic
1167407952 19:49326249-49326271 CTGGCTTCATAGAAGACAGCTGG + Intergenic
1167670148 19:50847418-50847440 CTGGCTTAATAGAAGGCAGCTGG - Intergenic
925577754 2:5378289-5378311 CTGGCTCATGAGAATGCAGGAGG - Intergenic
926280160 2:11439738-11439760 CTGGCCTAATAGAAGACAGATGG + Intergenic
927288042 2:21377446-21377468 CTGGCTTCCCAGAAGGAAGGAGG + Intergenic
927569213 2:24143598-24143620 CTTGCTTAATAGAAGACAGGTGG - Intronic
927901820 2:26825409-26825431 CTAGCTGAACAGAAGACAGCTGG - Intergenic
929763750 2:44827281-44827303 CTGGCTTAATAGAAGACAGCTGG + Intergenic
931310773 2:61078359-61078381 CTGACTTAACAGAAGACAACTGG - Intronic
931615231 2:64149154-64149176 CTCACTTAAAAGAAGTCAGGAGG - Intergenic
931678528 2:64722509-64722531 CTGGCTTAATAAAAGACAGCTGG - Intronic
932173401 2:69577774-69577796 CTGTCTCCACAGGAGGCAGGAGG + Intronic
932198600 2:69806012-69806034 CTGGCTTAATGGAAGACAGATGG + Intronic
935149599 2:100421819-100421841 CTGGCTTAATAGAAGACAGCTGG - Intergenic
935280022 2:101508898-101508920 CTGGCTTAATAGAAGACAGCTGG - Intergenic
935728165 2:106042216-106042238 CTGGTTCAACAGAAGCCAAGTGG - Intergenic
936344626 2:111665892-111665914 CTAGCATCACAGAAGGAAGGTGG - Intergenic
938114292 2:128592639-128592661 GTGGCTTAAAGGAAGGCAGAGGG - Intergenic
938224624 2:129605165-129605187 CTGGCTTACCAGCAAGCAGATGG + Intergenic
938834072 2:135081772-135081794 CTGTCTTAAAAGAACCCAGGCGG - Intronic
939516707 2:143177780-143177802 CTGGCTTAAGAGAAGACAGCAGG - Intronic
940129737 2:150367782-150367804 CTGACTTAACAGAAGACAGGTGG + Intergenic
940493598 2:154396630-154396652 CTGGCTTAATAGAAGATAGCTGG + Intronic
940851591 2:158692516-158692538 CTGGCATAAGAGAAGACAGCTGG + Intergenic
940916890 2:159265952-159265974 CTGGCATAGCAGAAGACAGCTGG - Intronic
941085133 2:161108575-161108597 CTGGCTTAATAGGAGACAGCTGG - Intergenic
941169807 2:162122438-162122460 ATGACTTAATAGAAGACAGGTGG - Intergenic
941646928 2:168050595-168050617 CTGGCTTTGCAGATGGCAGAAGG + Intronic
942320703 2:174733160-174733182 CTGGCTTAACTGGGGGCAGGAGG - Intergenic
942417974 2:175778568-175778590 CTGGTATAACAGAAGGAAGCTGG - Intergenic
943142074 2:183995350-183995372 CTGGCTTAAGAGAGGACAGATGG - Intergenic
943147070 2:184059132-184059154 CTGGCTAAATAGAAGACAGATGG - Intergenic
944534871 2:200698779-200698801 CAGGCTTAAAAGAAGGCAGCTGG + Intergenic
944919986 2:204402792-204402814 CTGGCATAAGAGAGGCCAGGTGG - Intergenic
945880789 2:215322827-215322849 CTGGCATAACAGCAGGCACATGG - Intronic
946287436 2:218715157-218715179 CTGACTTAATAGAAGACAGCTGG + Intronic
947232632 2:227903366-227903388 CTGGCTAAAAGGAAAGCAGGTGG + Intronic
947264434 2:228261354-228261376 CTGGTTTAACAGAAAAAAGGTGG - Intergenic
947314768 2:228844150-228844172 CTGGCTTAATAGAAGACAGCTGG + Intergenic
947463585 2:230323170-230323192 CGGGCTGAACAGAGGGCAGGCGG + Intergenic
947472421 2:230411733-230411755 CGGGCTGAACAGAGGGCAGGCGG + Intergenic
947511896 2:230763210-230763232 CTGGCTTAATAGAAAACAGCTGG + Intronic
948259302 2:236591042-236591064 CTGTCTGAGCAGGAGGCAGGAGG - Intergenic
948579042 2:238971678-238971700 CTGTGGTAACAGGAGGCAGGGGG - Intergenic
1170063870 20:12289383-12289405 CTGAGTTAACACATGGCAGGAGG + Intergenic
1170274976 20:14575323-14575345 CTGGCTTAATAAAAGACAGTTGG + Intronic
1171029503 20:21664662-21664684 CTGGCTTAATAGAAGATAGCTGG + Intergenic
1172962488 20:38808283-38808305 CTGGTTTAGGAGAAGGCAGAAGG + Intronic
1172967061 20:38843828-38843850 CTGGCTTAATGGAAGACAGTTGG + Intronic
1174859780 20:54079944-54079966 CTGCCTTAATAGAAGACAGCTGG - Intergenic
1174876801 20:54235222-54235244 CTAGCATAGCAGATGGCAGGAGG - Intergenic
1175328421 20:58145894-58145916 CTGGCTTGAGAGATGTCAGGAGG + Intergenic
1175458271 20:59131449-59131471 CTGACTTGACAGAGGGGAGGTGG + Intergenic
1176264822 20:64203649-64203671 CTGGCTCAACAGCAGCCATGGGG - Intronic
1176983199 21:15406645-15406667 CTGGCTTAAGAGAAGGCTTTGGG - Intergenic
1177901821 21:26926254-26926276 CTGTCTAAACAGAAGGTAGTTGG + Intronic
1179010329 21:37551485-37551507 CTGGCTGAACAGGAGCCAGCTGG - Intergenic
1179148353 21:38788737-38788759 CTGGTTTAATAGAAGGCAGCTGG - Intergenic
1180045897 21:45305002-45305024 CTCTCATAGCAGAAGGCAGGAGG - Intergenic
1181290926 22:21792981-21793003 CTGGCTTAATAGAAGACAGTTGG - Intronic
1181388817 22:22564388-22564410 CTGGGTGTACAGAGGGCAGGAGG + Exonic
1182375972 22:29848287-29848309 CTGGCTTAACAGAAAGCTGCTGG - Intergenic
1182398081 22:30051278-30051300 CTGGCTCAAAAGAAGACAGCTGG - Intergenic
1182621772 22:31622373-31622395 CTGTCTTAACAGGAAGAAGGAGG + Intronic
1182814183 22:33144875-33144897 ATTGCTAAACAGATGGCAGGAGG + Intergenic
1183304933 22:37077614-37077636 CTGGCTTCACAGACTACAGGCGG - Intronic
1183988026 22:41579980-41580002 CTGGCTTTCCAGCAGGTAGGTGG + Intronic
1184737788 22:46409435-46409457 CAGGCTTGACAGGAGGCAGACGG + Intronic
1184979870 22:48088434-48088456 CTGGTTTAACAGAAGACAGATGG - Intergenic
949096746 3:95433-95455 CTGGCTTTGCAGAAGGAAAGGGG - Intergenic
949441652 3:4087616-4087638 CTGGCTTCATAGAAGACAGTAGG + Intronic
950307638 3:11928675-11928697 CGTGCTCACCAGAAGGCAGGTGG - Intergenic
950337111 3:12204403-12204425 CTGGCTTAATAGGAGACAGCTGG + Intergenic
950572575 3:13811108-13811130 CTGGCTTAATAGAAGTCAGCTGG + Intergenic
950575794 3:13831452-13831474 GTGGCCGAACAGAAGGAAGGTGG + Intronic
950706195 3:14784084-14784106 CTGGCATTACGGAAGGCAGGGGG - Intergenic
950720103 3:14876621-14876643 CTGGCTGAACAGAAGGTAGCTGG + Intronic
950826568 3:15829272-15829294 CTGGCTTAACAGAAAATAGGTGG + Intronic
952082352 3:29774773-29774795 CTGGCTTAATAAAAGACAGCTGG - Intronic
953060505 3:39424919-39424941 TTGGCCTAACACAAGGCACGTGG - Intergenic
953357936 3:42270206-42270228 CCCACTTACCAGAAGGCAGGAGG + Intergenic
953718443 3:45335379-45335401 CAGGCATACTAGAAGGCAGGCGG + Intergenic
954079238 3:48203312-48203334 CTTTCTTAATAAAAGGCAGGAGG + Intergenic
954868160 3:53747252-53747274 CTGGCTTCACACATGACAGGTGG - Intronic
955343458 3:58143480-58143502 CTGTCTTCCCAGAAGGCATGTGG - Exonic
955798755 3:62664825-62664847 CTGGCTTCATAGAAGGCAACTGG + Intronic
958986926 3:100791474-100791496 CTGGCTTAAGAGAAGATAGCTGG - Intronic
962379435 3:134885691-134885713 CTGGGTCAACAGAACCCAGGGGG + Intronic
962859295 3:139383929-139383951 CTGACTTAACAGAAGACAGATGG + Intronic
962945154 3:140162074-140162096 CTGGCTTAATAGAAGACAGCTGG + Intronic
963294586 3:143532009-143532031 CTGGTTTAATGGAAGGCAGCTGG - Intronic
963793158 3:149604788-149604810 CTGGCAGGCCAGAAGGCAGGTGG + Intronic
964265736 3:154893484-154893506 CTGTCTTATTAGAGGGCAGGTGG - Intergenic
964471742 3:157064164-157064186 CTGGCCCAGCAGAAGGCAGCAGG - Intergenic
965627667 3:170697953-170697975 TTTGGTCAACAGAAGGCAGGGGG - Intronic
965877464 3:173344221-173344243 CTGGCTTAACAAAAGACAATTGG + Intergenic
965884296 3:173424804-173424826 AGGGCTCAGCAGAAGGCAGGAGG - Intronic
966590024 3:181672524-181672546 CTGGCTTAATAGAAGACAGCTGG - Intergenic
967500297 3:190189805-190189827 CTGGCTTAAAAGAAAGCAGCTGG - Intergenic
967756630 3:193177663-193177685 CTGGCTTAACTGAAGGCAGCTGG + Intergenic
968430300 4:554549-554571 CTGGCTGAGCAGAGGCCAGGTGG - Intergenic
968459051 4:714693-714715 CTGGCCTGGCAGAAGGCAGTGGG - Intronic
968519064 4:1027593-1027615 CTGGCTTCAAAGACGACAGGTGG + Intergenic
972728202 4:41765201-41765223 CTGGCTTCATAGAAGACAGCTGG + Intergenic
972798582 4:42448214-42448236 CTGGCTTAATAGAAAGCAGCTGG + Intronic
973670288 4:53210522-53210544 CTGGTTTAATAGAAGACAGCTGG - Intronic
974800326 4:66809153-66809175 TTGGCTGAACAGAAGACAGTTGG + Intergenic
975271419 4:72438533-72438555 CTGACTTAATAGAAGACAGTTGG + Intronic
976168982 4:82284383-82284405 AAGGCTTGAAAGAAGGCAGGTGG - Intergenic
976325124 4:83762631-83762653 CTTGGTTAACAGAATGGAGGGGG + Intergenic
976406706 4:84667629-84667651 CTGGCTCAATAGAAGACAGGTGG - Intergenic
978280820 4:107010978-107011000 CTCACTTAATAGAAGGCAGCTGG + Intronic
978454465 4:108872647-108872669 CTGACTTAATAGAAGGCAACTGG - Intronic
979275610 4:118811728-118811750 ATGGCTTAAAAGAAAGAAGGAGG - Intronic
979361254 4:119767583-119767605 CTGGCTTAATAAAAGGCAGTTGG + Intergenic
979568863 4:122191827-122191849 CTAGCTTAATAGAAAACAGGTGG - Intronic
979947938 4:126857913-126857935 TTGGCTTAATAGAAGACAGTTGG + Intergenic
980405536 4:132350656-132350678 CTGGCTTAATAGAAGACAGCTGG - Intergenic
980887161 4:138775628-138775650 CTGCCTTAACAGAAGACAGCTGG + Intergenic
981303100 4:143212785-143212807 CTGGCTTAACAGAAGACAGCTGG - Intronic
982210663 4:153032580-153032602 CTGGCTTAATAGAAGACTGCTGG + Intergenic
982240166 4:153292243-153292265 CTGGCTTAACAGAAGATGGCTGG - Intronic
983196340 4:164811036-164811058 CTGTCTAAAAAGAAGGAAGGAGG + Intergenic
984688610 4:182699637-182699659 TTGGCTTAACATGAGGCATGCGG - Intronic
984710938 4:182884249-182884271 CTGGCTTAATAGAAAACAGCTGG - Intergenic
984837856 4:184039322-184039344 CTGGCATAGCAGAAGGCACATGG + Intergenic
985999614 5:3620246-3620268 CTGGGTTCACAGATGGCTGGCGG - Intergenic
986325451 5:6669978-6670000 CTGGGCTGACAGAAGGCAGAGGG + Intergenic
987002670 5:13675969-13675991 GTGGATGAACAGGAGGCAGGTGG + Intergenic
987277932 5:16381639-16381661 TTGGTTTAATAGAAGGCAGCTGG - Intergenic
988485878 5:31667754-31667776 CCTGCTCACCAGAAGGCAGGAGG + Intronic
988992572 5:36685638-36685660 CTGGCTTAATACAAGACAGTTGG + Intronic
989219795 5:38944215-38944237 CTGGCTTAATAGAAGATAGCTGG + Intronic
990803058 5:59627541-59627563 CTGGCTTAACAAAAGGCTTTGGG - Intronic
991181870 5:63761270-63761292 ATGGCTTTACAGGAGACAGGTGG + Intergenic
991203538 5:64022343-64022365 CTGGCTTGAAAGAAGGCATAAGG - Intergenic
991256577 5:64621114-64621136 CTGGATTAACAAAAGCCAGGGGG - Intergenic
991274768 5:64831848-64831870 CTGGTTTAATAGAAGGCAGCTGG + Intronic
991581331 5:68158111-68158133 CTTGCTTAATAGAAGACAGTTGG + Intergenic
993379002 5:87184057-87184079 TTGGGATAACAGAAGGCAGTAGG - Intergenic
993662830 5:90660094-90660116 CTGGCTTAATAGAAGACAGCTGG - Intronic
994651220 5:102531556-102531578 CTGGTTTAACAGAAGTCATTTGG - Intergenic
995229250 5:109740054-109740076 CAGGCTTAACAAAGGGCTGGAGG - Intronic
995452498 5:112317680-112317702 CTAGCTTAACAGAAAGTAGCTGG - Intronic
995587334 5:113661741-113661763 CTAACTTAATAGAAGGCAGCTGG + Intergenic
996521970 5:124437236-124437258 CTGGCTACACTGGAGGCAGGAGG + Intergenic
996888746 5:128391348-128391370 CTGCCTTAATAGAAGCCAGCTGG - Intronic
997501650 5:134379785-134379807 CTGGCTTAACAGAAGATAGCTGG - Intronic
998001735 5:138631073-138631095 CTGGCTTTGGAGGAGGCAGGGGG - Intronic
999429442 5:151513173-151513195 CTGGCTTAATAGAAGATAGCTGG - Intronic
999977120 5:156922792-156922814 CTGGCTTAATAGGAGACAGAGGG - Intronic
1000626590 5:163546287-163546309 CTGGTTGAACTGAAGTCAGGAGG - Intergenic
1000958585 5:167572023-167572045 GGGGCTGAACAGAAGGCAGCTGG - Intronic
1003848869 6:10201711-10201733 CTTGCTTAATAGAAGACAGCTGG + Intronic
1003934628 6:10962772-10962794 CTGGCTTAATAGAAGCCAGCTGG + Intronic
1004097792 6:12576173-12576195 CTGGCTTAACAGAAGACAGCTGG - Intergenic
1004317954 6:14607372-14607394 CTGGCTTAATAGAAGACAGCTGG + Intergenic
1007182505 6:39940019-39940041 CTGGCTTAGTAGAAGGCAACTGG - Intergenic
1007270577 6:40633467-40633489 CTGGTTTATCAGAAGACAGCTGG - Intergenic
1007528931 6:42522859-42522881 TTGGCTTAACACATGGCTGGAGG - Intergenic
1008036491 6:46750462-46750484 CTGACTTAATAGAAGACAGCTGG + Intronic
1009879922 6:69554099-69554121 ATGGTTTAACAGATGGCAGATGG - Intergenic
1010068446 6:71713733-71713755 CTGGCTTAATAGAAGACAGCTGG - Intergenic
1011131893 6:84060253-84060275 CAGCCTTCAGAGAAGGCAGGTGG - Intronic
1011716431 6:90110074-90110096 CTGGCTTAACAGAGGACTGCTGG + Intronic
1012750860 6:103161908-103161930 CTGGCTTAATAGAAGACATCTGG + Intergenic
1013276283 6:108587816-108587838 CTGACTTAACACAATACAGGTGG - Intronic
1013402179 6:109809265-109809287 CTGGCTTAATAGAAGACAACTGG - Intronic
1013731231 6:113170035-113170057 CTGGCTTAACAGAAGACAGCTGG + Intergenic
1014143947 6:117974863-117974885 CTGACTTAATAGAAGACAAGTGG + Intronic
1015594328 6:134851737-134851759 GTGAGTTAACAGAAGGCAGGCGG + Intergenic
1016940372 6:149478321-149478343 CTGGGTTAATAGAAGACAGCTGG - Intronic
1017051463 6:150397845-150397867 CTTGGTTAAAAGAAGGGAGGGGG + Intronic
1017777094 6:157688951-157688973 CTGGCTTAACAAAAGCCTGCTGG - Intergenic
1017837811 6:158195184-158195206 ATGACTTAACTGGAGGCAGGAGG + Exonic
1017920611 6:158869276-158869298 CTGGCTTAAGAGAAGGGCAGAGG + Intergenic
1018079553 6:160247175-160247197 CTGGCTCACCTGAAGGGAGGCGG + Exonic
1019464055 7:1176775-1176797 CTGACTCATCAGAAGCCAGGTGG - Intergenic
1019991144 7:4692196-4692218 CTGGCTTAATAGAAGACAGCTGG + Intronic
1021777922 7:24072261-24072283 CCAGCTAAACAGAGGGCAGGAGG - Intergenic
1022057151 7:26749631-26749653 CTAGCTACTCAGAAGGCAGGAGG + Intronic
1022149312 7:27583973-27583995 CTGGCTTAATAGAAGACAGCTGG + Intronic
1022236013 7:28460943-28460965 CTAGCTACTCAGAAGGCAGGAGG + Intronic
1022334485 7:29409494-29409516 CTGGCTTAAAAGAAGACAGCTGG + Intronic
1023741306 7:43283366-43283388 CTGGTTTAACAGAAGACAGCTGG - Intronic
1024402672 7:48943407-48943429 CTGGCTTCATAGAAGGCTGTAGG + Intergenic
1024499942 7:50093958-50093980 CTGGGTAAAAAGAGGGCAGGTGG - Intronic
1024577787 7:50778847-50778869 CATTCTTAAAAGAAGGCAGGTGG + Intronic
1025005936 7:55354888-55354910 CTGGGTTAAGAGAAGGGATGTGG - Intergenic
1026153498 7:67808021-67808043 CTGGCTTAATGGAAGACAGCTGG - Intergenic
1026890235 7:73977454-73977476 CTGGCTGAAGAAAGGGCAGGTGG + Intergenic
1026894910 7:74004302-74004324 CTGGGTTAGCAGGGGGCAGGGGG + Intergenic
1026924292 7:74179081-74179103 CTGGCTTAATAGAACACAGCTGG + Intronic
1027484053 7:78737629-78737651 CTGGCTTCATAGAAGACAGCTGG - Intronic
1027881505 7:83844498-83844520 CTGGTTTAAAAGATGGCAGCTGG + Intergenic
1028557210 7:92136934-92136956 CTGGCTTAATAGAAGACTGTTGG - Intronic
1028942229 7:96534748-96534770 CTGGCTTAATACAAGGTAAGTGG - Intronic
1029048838 7:97661652-97661674 ATGGCTTATAAGAAGGCAAGAGG + Intergenic
1029534024 7:101145311-101145333 CTGGGTTATCAGGAGGGAGGAGG - Intergenic
1029899843 7:104027235-104027257 CTGGCTTACTAGAAGGCAGCTGG + Intergenic
1030551212 7:110962478-110962500 CTGGCTTAATAGAAAACAGCTGG + Intronic
1031452652 7:121940894-121940916 CTGGTATAGCAGCAGGCAGGGGG - Intronic
1033179328 7:139159646-139159668 CTGGCTTAACAGAGGATAGATGG - Intronic
1033375088 7:140752350-140752372 CTGGCTTAACAGCAGCCAGCTGG + Intronic
1034175078 7:149093360-149093382 CTGTCTTAACAAAAGGAAGCAGG + Intergenic
1034625522 7:152489274-152489296 CTGGCTTAATAGAGGACAGCTGG - Intergenic
1034975529 7:155447235-155447257 CTGGCTTAATAGAAGATAGTTGG - Intergenic
1036624691 8:10459075-10459097 CTGGCTTAATAGAAGACAGCTGG + Intergenic
1038498150 8:28021538-28021560 CTGGCTTAATAGAACACAGCTGG - Intergenic
1038621190 8:29144581-29144603 CTGGCTGAATATAAGGTAGGAGG - Intronic
1038636233 8:29289519-29289541 CTCCCTTCACAGAAGGAAGGTGG - Intergenic
1038977053 8:32710931-32710953 CATACTTAGCAGAAGGCAGGAGG - Intronic
1039662604 8:39483345-39483367 CTAGCTTAATAGAAGCCAGTAGG - Intergenic
1041692608 8:60703750-60703772 CTGGCTCAATAGAGGGAAGGTGG - Intronic
1042950200 8:74193386-74193408 CTGCCTTAACAGAAGCCGGCTGG + Intergenic
1043115348 8:76245706-76245728 CTGGCTTAATAGATGACAGCTGG + Intergenic
1043858809 8:85291801-85291823 CTGGCTAAATAGAAGACAGCTGG - Intergenic
1044732588 8:95241817-95241839 CTGGCTTAACAGAAGACAGCTGG + Intergenic
1044854487 8:96461002-96461024 CAGGCTCACCAGAAAGCAGGTGG + Intergenic
1045135720 8:99215594-99215616 GTGCCTTCACAGGAGGCAGGGGG - Intronic
1045674471 8:104591575-104591597 CTGGTTTAATAGAAGACAGCTGG + Intronic
1045689617 8:104746812-104746834 CTGGCTTAACAGAGGGAGGTAGG + Intronic
1047071668 8:121351847-121351869 CTGGTTTAATAGAAGACAGCTGG + Intergenic
1047376679 8:124305007-124305029 CTGGCTTAATAGAAGACAGCTGG - Intergenic
1047402530 8:124558646-124558668 CTGTCTGAGCAGCAGGCAGGGGG + Intronic
1049118539 8:140712289-140712311 TAGGCTTAACAGAAGGCAGCAGG + Intronic
1049403374 8:142440807-142440829 CTGGGTAGACAGAGGGCAGGAGG - Intergenic
1051111040 9:13637036-13637058 CTGGCTTTACAGATGGAATGGGG + Intergenic
1051435729 9:17029296-17029318 CTGGCTTAATTGAAGACAGCTGG + Intergenic
1051805173 9:20984593-20984615 CTGGCTTAATAGAAGACAGCTGG + Intronic
1051889506 9:21927830-21927852 ATGGCTAACCAGAAGGAAGGGGG + Intronic
1052349285 9:27441984-27442006 CTGGTTTAACAGAAGGCAACTGG - Intronic
1052985575 9:34484827-34484849 TGGGCTTTACAGAAGGCAGTAGG + Intronic
1053193862 9:36099342-36099364 CTGGCTTAATAGAACTCAGGTGG - Intronic
1053202744 9:36163761-36163783 CTGGCTTAACAGCAGGCATCTGG + Exonic
1053307172 9:36993154-36993176 CTGGCTTAATAGAAAACAGCTGG - Intronic
1054744085 9:68836785-68836807 CTGTCTTACCAGAAGCCAGGTGG + Intronic
1054917878 9:70512395-70512417 CTGTCTTAATAGAAGACAGCTGG - Intergenic
1055371958 9:75609617-75609639 CTGGCATAAAAGAAGACAGCTGG - Intergenic
1055604548 9:77954962-77954984 CTGGTTTAACAGAAATCATGCGG - Intronic
1055660451 9:78498206-78498228 CTGGCTTAACAGATGATAGCTGG + Intergenic
1056671173 9:88628253-88628275 CTACCTTAATAGAAGGCAGCTGG + Intergenic
1059429753 9:114242946-114242968 CTGGCTTAATAGAAGTCAGCTGG + Intronic
1060379143 9:123149612-123149634 CTTGCTTTACAAAAAGCAGGTGG + Intronic
1061343158 9:129999847-129999869 CTAGCTTAATAGAAGACAGCTGG + Intronic
1061417794 9:130457134-130457156 CTGGCTTGACAGAAAACAGATGG + Intronic
1061845183 9:133383982-133384004 CTGGATGAAGAGAAGGCTGGAGG + Intronic
1203790233 EBV:147518-147540 CTGACCCAACAGAAGCCAGGTGG - Intergenic
1186169813 X:6864724-6864746 CTGGCTTCAAAGATGGAAGGAGG - Intergenic
1186524492 X:10236079-10236101 CTGGCTTTATAGAATCCAGGAGG + Exonic
1186873548 X:13795538-13795560 CTGGCTTAACAGTAGACAGCTGG - Intronic
1187639758 X:21274950-21274972 ATGGCTTAGAAGAAGACAGGAGG - Intergenic
1187823582 X:23313245-23313267 TTGGCTTAATAGAAGACAGCTGG - Intergenic
1188147700 X:26634086-26634108 CTAGCCTAATAGAAGACAGGTGG + Intergenic
1188599508 X:31944301-31944323 TTAGCTTAAGAGAAGGCAGCTGG - Intronic
1189447858 X:41097690-41097712 CTGGCTTAATAGAAGACAACTGG + Intronic
1189485974 X:41432277-41432299 CTGACTTAATAGAAGACAGCTGG + Intergenic
1189942529 X:46139732-46139754 CTGGCGTAATAGAAGACAGCTGG + Intergenic
1190224416 X:48534314-48534336 GTGGCTTATCAGAAGCCAAGAGG - Intergenic
1190366727 X:49701773-49701795 CTTTCTTAACAAAAGGCAGCTGG + Intergenic
1190882449 X:54501634-54501656 ATGGCTTAATAGAAGACAGCTGG - Intergenic
1191587165 X:62840641-62840663 GTAGCTTAACTGAAAGCAGGTGG + Intergenic
1191725186 X:64271842-64271864 CTGGCTCAACACAGGGTAGGGGG + Intronic
1193640232 X:84003311-84003333 CTTGCTCAACAGGAGGCAGTTGG + Intergenic
1195052718 X:101112671-101112693 CTGGCTTAAGAGAACACAGTTGG - Intronic
1195616273 X:106914548-106914570 CTGGCTGAGCACAAGGCAGCTGG - Intronic
1195813525 X:108859830-108859852 CTGGCTTAAGCGAAGACAGCTGG + Intergenic
1196586212 X:117431491-117431513 CTTGCTTAACAGAAGGCAACTGG - Intergenic
1197955414 X:131941342-131941364 TGGGCTTAACAGAAGACAGCTGG - Intergenic
1198774106 X:140161399-140161421 CTGGCTTAACAGAAAATAGCTGG - Intergenic
1200056494 X:153464101-153464123 CAGGCTTGTCAGAGGGCAGGTGG - Intronic
1200947171 Y:8855179-8855201 CTGACTTAACAGCTGGCAGATGG + Intergenic
1200983807 Y:9285965-9285987 CTGGCTTAGGAACAGGCAGGAGG + Intergenic
1202126564 Y:21573735-21573757 CTGGCTTAGGAACAGGCAGGAGG - Intergenic