ID: 1076324097

View in Genome Browser
Species Human (GRCh38)
Location 10:129607708-129607730
Sequence CATGGTGAGCAGCTGTCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 172}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076324097_1076324102 8 Left 1076324097 10:129607708-129607730 CCCTTGGACAGCTGCTCACCATG 0: 1
1: 0
2: 0
3: 16
4: 172
Right 1076324102 10:129607739-129607761 CGAATTTCTGATGAAATTACAGG No data
1076324097_1076324104 15 Left 1076324097 10:129607708-129607730 CCCTTGGACAGCTGCTCACCATG 0: 1
1: 0
2: 0
3: 16
4: 172
Right 1076324104 10:129607746-129607768 CTGATGAAATTACAGGTGCAGGG No data
1076324097_1076324103 14 Left 1076324097 10:129607708-129607730 CCCTTGGACAGCTGCTCACCATG 0: 1
1: 0
2: 0
3: 16
4: 172
Right 1076324103 10:129607745-129607767 TCTGATGAAATTACAGGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076324097 Original CRISPR CATGGTGAGCAGCTGTCCAA GGG (reversed) Intronic
901248435 1:7752705-7752727 CATGGTTACCAGCACTCCAAGGG - Intronic
901533822 1:9869987-9870009 CGTGGTGAGCTGCTGTCCCAGGG + Intronic
907245627 1:53106764-53106786 AATGCTGTGCAGCTGACCAACGG + Intronic
907820168 1:57959684-57959706 CCTGATGAGAAGCTGTCCAAAGG + Intronic
908396290 1:63728595-63728617 CATGATGAGAAGCCCTCCAAGGG + Intergenic
910073540 1:83248231-83248253 CATGTGGTTCAGCTGTCCAAGGG + Intergenic
913529679 1:119724837-119724859 CATGGTGAGCAGTTGACAATGGG - Intronic
919112606 1:193239842-193239864 CATGGTGAACAGCTGCACAAAGG - Intronic
919134317 1:193489152-193489174 CATCGTAAGCACCTGGCCAAAGG + Intergenic
922182012 1:223243055-223243077 CATGGGGAGCATCTGGCCAGGGG - Intronic
922663317 1:227448488-227448510 GATGCTGAGCCGCTATCCAAGGG - Intergenic
922932018 1:229397227-229397249 CAGAGGGAGCAGCTGTGCAAAGG + Intergenic
1064993043 10:21273305-21273327 CTTGGAGACCAGCTCTCCAAGGG - Intergenic
1065312873 10:24433091-24433113 CATGGTGAGCTGCTGTGGAAAGG - Exonic
1067171542 10:43910899-43910921 CAGGGTGAGCGGCTGGCCTAGGG + Intergenic
1067187798 10:44044895-44044917 CTCGCTGAGCAGCTGACCAAGGG - Intergenic
1069273756 10:66564317-66564339 CATAATGAGCAGATGTACAATGG + Intronic
1069940941 10:71954860-71954882 CATGGTGAGCAGCTATGGAAGGG + Intergenic
1070836143 10:79448062-79448084 CATGTTGAGCAGCTGTCCTGTGG - Intergenic
1072750806 10:97977248-97977270 CATGATGAGCAGCTTGCCAAAGG - Intronic
1074251192 10:111749922-111749944 AATGGGGAGCTGTTGTCCAAGGG + Intergenic
1075632664 10:124010644-124010666 CATGGAGAGCAGCCCACCAAGGG - Intronic
1076324097 10:129607708-129607730 CATGGTGAGCAGCTGTCCAAGGG - Intronic
1077573010 11:3355413-3355435 CCTGGTGAGCAGCTATGGAAGGG + Intronic
1080308984 11:30867736-30867758 CCTGGTGAGCACCTGTAGAAAGG + Intronic
1080368590 11:31608516-31608538 CCTGGTGAGCAGCTATGGAAGGG + Intronic
1080557665 11:33431858-33431880 CATGGTGGGCTGCAGTCCCAAGG + Intergenic
1081162876 11:39772468-39772490 CATGGTGAGCAGCTCCCCCAAGG + Intergenic
1083681297 11:64353022-64353044 CAAGGAGAGCTGCTCTCCAAGGG - Intronic
1084653961 11:70504575-70504597 CAGGGTGACCAGCTGTCCAGTGG - Intronic
1086091264 11:83007585-83007607 CATAGTGAGAAGCTGGCCATGGG + Intronic
1086302312 11:85440492-85440514 CAAGTTAAGCAGCTGTACAAAGG - Intronic
1088828274 11:113513994-113514016 CCTGTTGACCAGGTGTCCAATGG + Intergenic
1092125758 12:6073990-6074012 CATGGAGAGCAGGCGACCAAGGG - Intronic
1092948110 12:13475514-13475536 CATGGGGAGGAGCTGGCCCATGG + Intergenic
1093336504 12:17911940-17911962 CATGGAAAGCACCTGTCCCATGG + Intergenic
1093821349 12:23622113-23622135 GATGGTGGGAAGCAGTCCAAAGG - Intronic
1095158467 12:38887263-38887285 CCTGGAGAGCATCTCTCCAAGGG - Intronic
1101632560 12:106509744-106509766 CATGGTCAGCATCTCTCCCATGG - Exonic
1103679478 12:122681832-122681854 CATGGTGACCAGGTGTCCTTGGG - Intergenic
1104663323 12:130628111-130628133 CATGGGGAACAGCCGTGCAAAGG - Intronic
1108412517 13:50164136-50164158 CATGCTGGTGAGCTGTCCAATGG - Intronic
1110878011 13:80534793-80534815 CAGGCTGAGCATCTTTCCAAAGG - Intergenic
1111331175 13:86763013-86763035 TATGGTGAGCAGCTATGGAAGGG + Intergenic
1112343956 13:98576084-98576106 CCTGGTGCGCGGCTGTCCGAGGG + Intronic
1115420436 14:33187688-33187710 CATAGTGAGAACCTGTCTAAGGG + Intronic
1117477735 14:56114261-56114283 AATGGTGAGCTGCTGTTCAATGG + Intergenic
1119022011 14:71124120-71124142 CATGGTGAGCAGCTGAACCTGGG - Intergenic
1121787840 14:96675825-96675847 CCTGGTGAGCAGCTACCCATGGG + Intergenic
1122297545 14:100713848-100713870 CAGGCTGAGCAGCTGTCCCTGGG + Intergenic
1123583301 15:21735943-21735965 CATGGTGAGGAGCTGTGCTCTGG + Intergenic
1123619951 15:22178540-22178562 CATGGTGAGGAGCTGTGCTCTGG + Intergenic
1123915505 15:25021482-25021504 TATGGTGAGCAGTTCCCCAATGG - Intergenic
1124118615 15:26869035-26869057 CCTGGTGTGCAGCTGTCCTGGGG + Intronic
1125651188 15:41319254-41319276 CATAGTGAGATTCTGTCCAAAGG - Intronic
1127673741 15:61220661-61220683 CACGGTGAGCTGCTTTCCTAGGG - Intronic
1128418996 15:67473725-67473747 CATGGAGGGCAGATGACCAAGGG + Intronic
1128893089 15:71348454-71348476 CATGGTGAGCAGGTGTTCTGAGG - Intronic
1130941082 15:88509793-88509815 TATGGTGAGGACCTCTCCAACGG + Intergenic
1132012409 15:98287694-98287716 CAGGGTGAGGGGCTGCCCAATGG + Intergenic
1133517993 16:6528499-6528521 AATGGTGAACAGCTGGGCAAAGG + Intronic
1134400855 16:13908365-13908387 CATGGAGAACAACTGTGCAAAGG - Intergenic
1134865465 16:17603166-17603188 CATGCTGAGCTGCTCTTCAATGG - Intergenic
1137572557 16:49576294-49576316 CCTGGCCAGCTGCTGTCCAAGGG + Intronic
1138560887 16:57800462-57800484 CCTGCAGACCAGCTGTCCAATGG + Intronic
1139740373 16:69030453-69030475 CAGAGGGAGCAGCTGTGCAAAGG + Intronic
1142141779 16:88475861-88475883 CAGGCTGAGCAGCCGTCCAGGGG - Intronic
1146735563 17:35235836-35235858 CATGGTTAGCTGGTGTCCCAAGG + Intergenic
1147253185 17:39165740-39165762 CTTGGCGATCAGCTGTCCCATGG + Exonic
1148391225 17:47274652-47274674 CATGGTGAGGAGCTGTCATGGGG + Intronic
1149024391 17:52009479-52009501 CCTGGAGAGCAGATGTCCTATGG + Intronic
1149531367 17:57397799-57397821 ACTGGTGAGCAGCTAACCAAGGG + Intronic
1150812665 17:68368895-68368917 AATGCTGAGCACCTGTCCATTGG + Intronic
1150813700 17:68376639-68376661 AATGGTGAGCAACTGTTTAAAGG - Intronic
1151959748 17:77399415-77399437 CATGGTGTGCCTCTGTCCTATGG - Intronic
1152260697 17:79265322-79265344 CATGGGGAGCAGCTGGCCTCCGG + Intronic
1152545990 17:81000345-81000367 CATGGAGGGCAGCTGCCCAGAGG - Intronic
1152594838 17:81233048-81233070 GCTGGTGAGCAGTTGTCCACTGG + Intronic
1153570919 18:6473028-6473050 AATGGAGAGTTGCTGTCCAATGG + Intergenic
1153698472 18:7668186-7668208 CATGGTGAGGAGCTGCACCACGG + Intronic
1155254321 18:23981648-23981670 AATGCTGAGCAGCTGTCAGAGGG - Intergenic
1155576696 18:27255459-27255481 CATGGTAACCTGCTGTCCGATGG + Intergenic
1157102560 18:44743769-44743791 TATGTTGGGCAGCTGTCCATGGG - Intronic
1157944031 18:51958729-51958751 CATGGTGACTGGCTGTCCCATGG - Intergenic
1158655396 18:59326245-59326267 CATGATGAGGAACTGTTCAAAGG - Intergenic
1160314975 18:77834727-77834749 CATAGTGAGCTGTTTTCCAATGG + Intergenic
1161487192 19:4542809-4542831 CATCGGCAGCAGCTGTCTAAAGG - Exonic
1161520588 19:4721458-4721480 CATGATGCGCAGTTGCCCAAAGG + Intronic
1162186161 19:8906651-8906673 AATGGTGAGCAGCTGTGATATGG - Exonic
1163588019 19:18174287-18174309 CAAGTTCAGCAGCTGGCCAAGGG + Intronic
1165058408 19:33193687-33193709 CTTGGTGGGCAGCTCTCCAGAGG + Intronic
1167745231 19:51346881-51346903 CATGGTGAGCCCCTGGCCAGCGG - Exonic
1168152180 19:54455157-54455179 CAGGGTGGGCAGCTGGCCAGTGG - Intronic
1168676986 19:58285820-58285842 TATGGAGAGCAGGTGACCAAAGG - Exonic
925616801 2:5751522-5751544 CATGGCCAGCAGGTGTCCAAGGG + Intergenic
927201074 2:20578391-20578413 CATGGTGAGCAACTTTTCAGAGG - Intronic
927444051 2:23142163-23142185 CATGGAGTCTAGCTGTCCAAGGG - Intergenic
929585525 2:43111780-43111802 CATGGTGGGCAGCTTTCCTGAGG - Intergenic
932601438 2:73129292-73129314 GATTGTGATCAGCTGTCCAAGGG - Intronic
933158951 2:79003078-79003100 CATGGTGACCAGCAGCCCAGAGG + Intergenic
933628967 2:84634955-84634977 CATTGTGACCAGATCTCCAAAGG - Intronic
935717515 2:105952287-105952309 CCTGGGGAGCTGCTGGCCAAGGG - Intergenic
935979668 2:108614226-108614248 CATGGTGAGGACCTGTCAAGGGG - Intronic
938619033 2:133030406-133030428 CATGGTGAGCCTGTGTCGAAAGG + Intronic
939159075 2:138564247-138564269 CATGTTGAGCAGCTTTACTAAGG - Intronic
939897689 2:147811305-147811327 CATGGTCAGCAGCAGGGCAAAGG - Intergenic
943099906 2:183475162-183475184 TTTGGGGACCAGCTGTCCAAGGG - Intergenic
1168767030 20:388613-388635 CAGGGGGAACAGCTGTTCAAAGG + Intronic
1169141945 20:3231386-3231408 CATGGTGAGCCACGGTCCAGTGG - Exonic
1170538288 20:17363378-17363400 CATGGTTAGCTGCTGTCTAAAGG + Intronic
1171033869 20:21701396-21701418 CTTGGTCAGCAGCAGGCCAAAGG + Intergenic
1171135162 20:22688919-22688941 CTCTGTGAGCAGCTGTCCCAAGG + Intergenic
1174666077 20:52258939-52258961 AATGGGGAGCTGCTGTTCAATGG + Intergenic
1175461330 20:59153805-59153827 CTTGGTAAGCAATTGTCCAATGG - Intergenic
1175958050 20:62621407-62621429 CATGGTGAGCGGCCGAGCAAGGG - Intergenic
1176873881 21:14106790-14106812 GATTGTGAGCAGATGCCCAAGGG + Intergenic
1178853516 21:36232463-36232485 CAAGGTGAGGAGCCCTCCAAGGG - Intronic
1179158181 21:38869341-38869363 CAAAGTGAGCAGATGTCCCAGGG - Intergenic
1181938955 22:26460495-26460517 CATGCTGAGCTGGTGTCCAGAGG + Intronic
1182452217 22:30428423-30428445 GGTGGTGAGCAGGTGACCAAGGG - Intronic
1182467437 22:30526012-30526034 GAGGGAGAGCAGCTGGCCAAAGG - Intronic
1184329499 22:43818096-43818118 CATGGAGAGCGGCTCTCCACAGG + Intergenic
1184770234 22:46592683-46592705 TATGGTGACCAGCTCTGCAAGGG + Intronic
953467236 3:43133184-43133206 CCTGGTCTGCATCTGTCCAAAGG + Intergenic
955516705 3:59733079-59733101 CAAGGTGAGCAATTTTCCAAGGG + Intergenic
956012682 3:64848423-64848445 CAAGTTGAGAAGGTGTCCAAAGG - Intergenic
957764771 3:84609198-84609220 CATGCTGAGCAACTTTACAAAGG - Intergenic
959270115 3:104196425-104196447 CATGGGGAACTGCTGTCTAAAGG + Intergenic
962426201 3:135271300-135271322 CATGAGGGGCAGCTGCCCAATGG - Intergenic
962867483 3:139459727-139459749 CATGCAGAGCAGATGCCCAAGGG - Intronic
964358220 3:155870018-155870040 TCTGGTGAGCAGCTGGCCCAGGG - Intergenic
968983273 4:3862470-3862492 CTGGGTGGGCAGCTGTCCAGAGG - Intergenic
969449439 4:7264714-7264736 CATGGTGAGGGGCTTTCCATAGG - Intronic
971418936 4:26457907-26457929 ACTGGTGAGAAGTTGTCCAAGGG + Intergenic
976886698 4:89994018-89994040 CATGCTAAGCATTTGTCCAAAGG + Intergenic
982474550 4:155834496-155834518 TAAGGTGAGCAGCTGAACAAAGG - Intronic
982673194 4:158347006-158347028 CAGGGTGGTCAGCTCTCCAAAGG - Intronic
983767935 4:171510055-171510077 GATGGTGAGCATGTTTCCAAGGG - Intergenic
987122613 5:14781282-14781304 CAGGGGGAGCAGCAGTCAAACGG + Intronic
990332480 5:54741248-54741270 CAATGTGAGCAGATGTGCAAAGG + Intergenic
991011076 5:61883662-61883684 CATGAAGATCAGCTGTGCAATGG + Intergenic
993426978 5:87777457-87777479 CATGGTCACCAGCTATCAAATGG - Intergenic
995731774 5:115251560-115251582 CATGGTGAGTAAGTGACCAATGG + Intronic
995885847 5:116893390-116893412 TATGGAGAGCATCTGTCCCAAGG - Intergenic
997477141 5:134150107-134150129 AATGGGGAGCAGCTGTACCAGGG - Exonic
1001483708 5:172105270-172105292 CTGGGTGAGCAGATGTCCACAGG - Intronic
1002568326 5:180126646-180126668 AATGGTGTGCAGCTGTGAAAGGG - Intronic
1003127002 6:3363512-3363534 CAAGGTGAGCAGCAGGCCATGGG - Intronic
1006254529 6:32819916-32819938 CATGAAGAGCAGCTGCCCCAGGG + Intronic
1009529502 6:64793974-64793996 AATGGGGAGCTGCTGTTCAATGG - Intronic
1012368269 6:98469906-98469928 CAACATGAGCAACTGTCCAAAGG - Intergenic
1013478070 6:110528049-110528071 CCAGGGGAGCAGCTGTCAAAAGG - Intergenic
1014020553 6:116583371-116583393 AATGGTGAGATGCTGGCCAAAGG + Intronic
1017383234 6:153854839-153854861 CATTGTGAGGAACTGCCCAACGG - Intergenic
1017560667 6:155624929-155624951 CATGGTGCCCAGCTGTCACAGGG + Intergenic
1018373060 6:163186269-163186291 CCTGGAGAGCTGCTGTCCAATGG + Intronic
1020787910 7:12592503-12592525 CATGGTGAGCAGCTACGGAAGGG + Intronic
1021530503 7:21639380-21639402 CCTGGTTAGCAGCTTTCCTAGGG + Intronic
1023493903 7:40773581-40773603 AATGATGAGCAGCTCTCCGATGG + Intronic
1023683714 7:42714522-42714544 CATGGGGAGCAGCTGACACATGG - Intergenic
1023687575 7:42752342-42752364 CATGGGGAGCAGATGGCGAAGGG - Intergenic
1023938683 7:44756787-44756809 CAGGGAAAGCAGCTGTCCACAGG - Intronic
1026555836 7:71407918-71407940 GATGGGGAGCAGCTGCTCAATGG + Intronic
1027250870 7:76397925-76397947 CGGGGTGAGCAGATGCCCAAGGG - Intronic
1027291224 7:76713105-76713127 CATGTGGTTCAGCTGTCCAAGGG + Intergenic
1029187562 7:98750639-98750661 CATGGTGAGTATCTTTCCATGGG - Intergenic
1033296700 7:140144900-140144922 CATGGTGAGAAGAGGTACAAGGG - Intronic
1037763415 8:21756963-21756985 AATGGTAAACAGCTGCCCAAGGG + Intronic
1038320935 8:26526813-26526835 CATGGGGCGCCTCTGTCCAAGGG + Intronic
1038697836 8:29821727-29821749 CATGGTGAGCTGTTGACCACAGG - Intergenic
1046743697 8:117854751-117854773 CTTGGTGTGCAGCTGTGAAATGG - Intronic
1048514513 8:135093684-135093706 CATGGTGGGAAGCTCTGCAAGGG + Intergenic
1049603925 8:143520416-143520438 CAGGGTGGGCAGCTGGCCATCGG - Intronic
1052212817 9:25927248-25927270 AATGGGGAGCTGCTGTTCAATGG + Intergenic
1058907991 9:109497427-109497449 CAAGGTCACCAGCTGGCCAAGGG + Intronic
1058910820 9:109518471-109518493 CCTGATCAGCACCTGTCCAATGG - Intergenic
1060047845 9:120354583-120354605 CCTGGTGAGCAGCTCTCAACTGG + Intergenic
1060528439 9:124333547-124333569 CTCGGTGAGCATCTGTGCAACGG - Intronic
1061749083 9:132763020-132763042 AGTGGTGAGCAGGTGTCCAAAGG - Intronic
1062206528 9:135340749-135340771 CATGGTGAGAAGCCATTCAATGG - Intergenic
1062616146 9:137396914-137396936 CGTGGGGAGCAGCTGTCCTGGGG - Intronic
1185448488 X:270897-270919 CATGGGGAGCACCCCTCCAATGG - Intergenic
1185494624 X:545004-545026 CCTGGGGAGCTGCTGTCCAGGGG + Intergenic
1187939327 X:24365974-24365996 AATGGGGAGCTGCTGTTCAATGG - Intergenic
1188608112 X:32059098-32059120 AATGGTGAGATGCTGTGCAATGG + Intronic
1191667302 X:63716620-63716642 CATGGTGACCAGGTATCCAGAGG - Intronic
1195313559 X:103656642-103656664 CATTGTGGGAAGCTGTCCATTGG + Intergenic
1197021044 X:121689448-121689470 AATGGTGAGTTGCTGTTCAATGG - Intergenic
1201274461 Y:12285203-12285225 CCTGGTGAGCAGCTGTGGAAGGG + Intergenic