ID: 1076324217

View in Genome Browser
Species Human (GRCh38)
Location 10:129608841-129608863
Sequence GGCCACTCCCTTTCATCTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076324210_1076324217 0 Left 1076324210 10:129608818-129608840 CCAGCTGAGGCCCCGTCCGCCTT No data
Right 1076324217 10:129608841-129608863 GGCCACTCCCTTTCATCTCCCGG No data
1076324212_1076324217 -10 Left 1076324212 10:129608828-129608850 CCCCGTCCGCCTTGGCCACTCCC 0: 1
1: 0
2: 1
3: 15
4: 187
Right 1076324217 10:129608841-129608863 GGCCACTCCCTTTCATCTCCCGG No data
1076324205_1076324217 15 Left 1076324205 10:129608803-129608825 CCCAGCGCGTGCTCCCCAGCTGA 0: 1
1: 0
2: 0
3: 7
4: 95
Right 1076324217 10:129608841-129608863 GGCCACTCCCTTTCATCTCCCGG No data
1076324206_1076324217 14 Left 1076324206 10:129608804-129608826 CCAGCGCGTGCTCCCCAGCTGAG 0: 1
1: 0
2: 0
3: 10
4: 102
Right 1076324217 10:129608841-129608863 GGCCACTCCCTTTCATCTCCCGG No data
1076324209_1076324217 1 Left 1076324209 10:129608817-129608839 CCCAGCTGAGGCCCCGTCCGCCT 0: 1
1: 0
2: 0
3: 14
4: 135
Right 1076324217 10:129608841-129608863 GGCCACTCCCTTTCATCTCCCGG No data
1076324203_1076324217 30 Left 1076324203 10:129608788-129608810 CCCAGGGGCAGGAGGCCCAGCGC 0: 1
1: 0
2: 2
3: 38
4: 346
Right 1076324217 10:129608841-129608863 GGCCACTCCCTTTCATCTCCCGG No data
1076324208_1076324217 2 Left 1076324208 10:129608816-129608838 CCCCAGCTGAGGCCCCGTCCGCC 0: 1
1: 0
2: 0
3: 19
4: 232
Right 1076324217 10:129608841-129608863 GGCCACTCCCTTTCATCTCCCGG No data
1076324204_1076324217 29 Left 1076324204 10:129608789-129608811 CCAGGGGCAGGAGGCCCAGCGCG 0: 1
1: 0
2: 2
3: 39
4: 318
Right 1076324217 10:129608841-129608863 GGCCACTCCCTTTCATCTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076324217 Original CRISPR GGCCACTCCCTTTCATCTCC CGG Intronic
No off target data available for this crispr