ID: 1076329096

View in Genome Browser
Species Human (GRCh38)
Location 10:129652086-129652108
Sequence GTGTAGGAGTAGATGTGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076329091_1076329096 -4 Left 1076329091 10:129652067-129652089 CCGGGGTTTGTGGGATCGTGTGT 0: 1
1: 0
2: 1
3: 8
4: 128
Right 1076329096 10:129652086-129652108 GTGTAGGAGTAGATGTGGAGGGG No data
1076329085_1076329096 18 Left 1076329085 10:129652045-129652067 CCGGGAAAGCTGCTGTCGGAAGC 0: 1
1: 0
2: 3
3: 12
4: 124
Right 1076329096 10:129652086-129652108 GTGTAGGAGTAGATGTGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076329096 Original CRISPR GTGTAGGAGTAGATGTGGAG GGG Intronic
No off target data available for this crispr