ID: 1076330321

View in Genome Browser
Species Human (GRCh38)
Location 10:129659559-129659581
Sequence AATAATAATGCCAGTAGCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076330321_1076330323 4 Left 1076330321 10:129659559-129659581 CCGAGGCTACTGGCATTATTATT No data
Right 1076330323 10:129659586-129659608 GATGAGTTAGTGCAAATTGAGGG No data
1076330321_1076330325 10 Left 1076330321 10:129659559-129659581 CCGAGGCTACTGGCATTATTATT No data
Right 1076330325 10:129659592-129659614 TTAGTGCAAATTGAGGGGTGAGG No data
1076330321_1076330324 5 Left 1076330321 10:129659559-129659581 CCGAGGCTACTGGCATTATTATT No data
Right 1076330324 10:129659587-129659609 ATGAGTTAGTGCAAATTGAGGGG No data
1076330321_1076330322 3 Left 1076330321 10:129659559-129659581 CCGAGGCTACTGGCATTATTATT No data
Right 1076330322 10:129659585-129659607 TGATGAGTTAGTGCAAATTGAGG No data
1076330321_1076330326 28 Left 1076330321 10:129659559-129659581 CCGAGGCTACTGGCATTATTATT No data
Right 1076330326 10:129659610-129659632 TGAGGAAGTAGCATGTACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076330321 Original CRISPR AATAATAATGCCAGTAGCCT CGG (reversed) Intronic
No off target data available for this crispr