ID: 1076330322

View in Genome Browser
Species Human (GRCh38)
Location 10:129659585-129659607
Sequence TGATGAGTTAGTGCAAATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076330321_1076330322 3 Left 1076330321 10:129659559-129659581 CCGAGGCTACTGGCATTATTATT No data
Right 1076330322 10:129659585-129659607 TGATGAGTTAGTGCAAATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076330322 Original CRISPR TGATGAGTTAGTGCAAATTG AGG Intronic
No off target data available for this crispr