ID: 1076332455

View in Genome Browser
Species Human (GRCh38)
Location 10:129680467-129680489
Sequence ATGGAAAGGCAGACTCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076332447_1076332455 24 Left 1076332447 10:129680420-129680442 CCTAGGCATCTGTATTTGGTTAC 0: 1
1: 0
2: 0
3: 18
4: 177
Right 1076332455 10:129680467-129680489 ATGGAAAGGCAGACTCAGGAAGG No data
1076332445_1076332455 30 Left 1076332445 10:129680414-129680436 CCTTCTCCTAGGCATCTGTATTT 0: 1
1: 0
2: 3
3: 19
4: 277
Right 1076332455 10:129680467-129680489 ATGGAAAGGCAGACTCAGGAAGG No data
1076332451_1076332455 -2 Left 1076332451 10:129680446-129680468 CCAGCACTGAGACATGCAGGCAT 0: 1
1: 0
2: 4
3: 14
4: 204
Right 1076332455 10:129680467-129680489 ATGGAAAGGCAGACTCAGGAAGG No data
1076332448_1076332455 2 Left 1076332448 10:129680442-129680464 CCCGCCAGCACTGAGACATGCAG 0: 1
1: 0
2: 5
3: 21
4: 212
Right 1076332455 10:129680467-129680489 ATGGAAAGGCAGACTCAGGAAGG No data
1076332449_1076332455 1 Left 1076332449 10:129680443-129680465 CCGCCAGCACTGAGACATGCAGG No data
Right 1076332455 10:129680467-129680489 ATGGAAAGGCAGACTCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076332455 Original CRISPR ATGGAAAGGCAGACTCAGGA AGG Intronic
No off target data available for this crispr