ID: 1076336394

View in Genome Browser
Species Human (GRCh38)
Location 10:129709630-129709652
Sequence CTGCATAATCATATGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076336391_1076336394 -7 Left 1076336391 10:129709614-129709636 CCAGGGCAGGAGGTATCTGCATA 0: 1
1: 0
2: 1
3: 9
4: 146
Right 1076336394 10:129709630-129709652 CTGCATAATCATATGGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076336394 Original CRISPR CTGCATAATCATATGGAGGC TGG Intronic
No off target data available for this crispr