ID: 1076336966

View in Genome Browser
Species Human (GRCh38)
Location 10:129713464-129713486
Sequence ATCCACTCTCAGCTGTGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076336966_1076336977 10 Left 1076336966 10:129713464-129713486 CCCATCCACAGCTGAGAGTGGAT No data
Right 1076336977 10:129713497-129713519 CGGGTTTCCAGGTGGCCAGTAGG No data
1076336966_1076336980 26 Left 1076336966 10:129713464-129713486 CCCATCCACAGCTGAGAGTGGAT No data
Right 1076336980 10:129713513-129713535 CAGTAGGATTGTCCGATGTCTGG No data
1076336966_1076336971 -10 Left 1076336966 10:129713464-129713486 CCCATCCACAGCTGAGAGTGGAT No data
Right 1076336971 10:129713477-129713499 GAGAGTGGATGGCAGGCCCGCGG No data
1076336966_1076336973 -1 Left 1076336966 10:129713464-129713486 CCCATCCACAGCTGAGAGTGGAT No data
Right 1076336973 10:129713486-129713508 TGGCAGGCCCGCGGGTTTCCAGG No data
1076336966_1076336972 -9 Left 1076336966 10:129713464-129713486 CCCATCCACAGCTGAGAGTGGAT No data
Right 1076336972 10:129713478-129713500 AGAGTGGATGGCAGGCCCGCGGG No data
1076336966_1076336974 2 Left 1076336966 10:129713464-129713486 CCCATCCACAGCTGAGAGTGGAT No data
Right 1076336974 10:129713489-129713511 CAGGCCCGCGGGTTTCCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076336966 Original CRISPR ATCCACTCTCAGCTGTGGAT GGG (reversed) Intronic