ID: 1076336967

View in Genome Browser
Species Human (GRCh38)
Location 10:129713465-129713487
Sequence CATCCACTCTCAGCTGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076336967_1076336972 -10 Left 1076336967 10:129713465-129713487 CCATCCACAGCTGAGAGTGGATG No data
Right 1076336972 10:129713478-129713500 AGAGTGGATGGCAGGCCCGCGGG No data
1076336967_1076336974 1 Left 1076336967 10:129713465-129713487 CCATCCACAGCTGAGAGTGGATG No data
Right 1076336974 10:129713489-129713511 CAGGCCCGCGGGTTTCCAGGTGG No data
1076336967_1076336977 9 Left 1076336967 10:129713465-129713487 CCATCCACAGCTGAGAGTGGATG No data
Right 1076336977 10:129713497-129713519 CGGGTTTCCAGGTGGCCAGTAGG No data
1076336967_1076336980 25 Left 1076336967 10:129713465-129713487 CCATCCACAGCTGAGAGTGGATG No data
Right 1076336980 10:129713513-129713535 CAGTAGGATTGTCCGATGTCTGG No data
1076336967_1076336973 -2 Left 1076336967 10:129713465-129713487 CCATCCACAGCTGAGAGTGGATG No data
Right 1076336973 10:129713486-129713508 TGGCAGGCCCGCGGGTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076336967 Original CRISPR CATCCACTCTCAGCTGTGGA TGG (reversed) Intronic