ID: 1076336969

View in Genome Browser
Species Human (GRCh38)
Location 10:129713469-129713491
Sequence CTGCCATCCACTCTCAGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076336969_1076336977 5 Left 1076336969 10:129713469-129713491 CCACAGCTGAGAGTGGATGGCAG No data
Right 1076336977 10:129713497-129713519 CGGGTTTCCAGGTGGCCAGTAGG No data
1076336969_1076336974 -3 Left 1076336969 10:129713469-129713491 CCACAGCTGAGAGTGGATGGCAG No data
Right 1076336974 10:129713489-129713511 CAGGCCCGCGGGTTTCCAGGTGG No data
1076336969_1076336980 21 Left 1076336969 10:129713469-129713491 CCACAGCTGAGAGTGGATGGCAG No data
Right 1076336980 10:129713513-129713535 CAGTAGGATTGTCCGATGTCTGG No data
1076336969_1076336973 -6 Left 1076336969 10:129713469-129713491 CCACAGCTGAGAGTGGATGGCAG No data
Right 1076336973 10:129713486-129713508 TGGCAGGCCCGCGGGTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076336969 Original CRISPR CTGCCATCCACTCTCAGCTG TGG (reversed) Intronic