ID: 1076336974

View in Genome Browser
Species Human (GRCh38)
Location 10:129713489-129713511
Sequence CAGGCCCGCGGGTTTCCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076336969_1076336974 -3 Left 1076336969 10:129713469-129713491 CCACAGCTGAGAGTGGATGGCAG No data
Right 1076336974 10:129713489-129713511 CAGGCCCGCGGGTTTCCAGGTGG No data
1076336967_1076336974 1 Left 1076336967 10:129713465-129713487 CCATCCACAGCTGAGAGTGGATG No data
Right 1076336974 10:129713489-129713511 CAGGCCCGCGGGTTTCCAGGTGG No data
1076336966_1076336974 2 Left 1076336966 10:129713464-129713486 CCCATCCACAGCTGAGAGTGGAT No data
Right 1076336974 10:129713489-129713511 CAGGCCCGCGGGTTTCCAGGTGG No data
1076336964_1076336974 27 Left 1076336964 10:129713439-129713461 CCAGGAAAGGTGAAAAGAAGAAG No data
Right 1076336974 10:129713489-129713511 CAGGCCCGCGGGTTTCCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076336974 Original CRISPR CAGGCCCGCGGGTTTCCAGG TGG Intronic