ID: 1076338647

View in Genome Browser
Species Human (GRCh38)
Location 10:129727884-129727906
Sequence GGATTTGAACACATGGAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076338645_1076338647 -4 Left 1076338645 10:129727865-129727887 CCAGACTTTGAGGTAGATGGGAT No data
Right 1076338647 10:129727884-129727906 GGATTTGAACACATGGAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076338647 Original CRISPR GGATTTGAACACATGGAGTA AGG Intronic
No off target data available for this crispr