ID: 1076342541

View in Genome Browser
Species Human (GRCh38)
Location 10:129759617-129759639
Sequence AGGAGTGGCAAGCGGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076342528_1076342541 29 Left 1076342528 10:129759565-129759587 CCACTGCATGAGCTCCTGGTTGT 0: 1
1: 0
2: 2
3: 12
4: 157
Right 1076342541 10:129759617-129759639 AGGAGTGGCAAGCGGGCAGAGGG No data
1076342530_1076342541 15 Left 1076342530 10:129759579-129759601 CCTGGTTGTCACAGTGAGCAGGA 0: 1
1: 0
2: 0
3: 25
4: 197
Right 1076342541 10:129759617-129759639 AGGAGTGGCAAGCGGGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076342541 Original CRISPR AGGAGTGGCAAGCGGGCAGA GGG Intronic
No off target data available for this crispr