ID: 1076343517

View in Genome Browser
Species Human (GRCh38)
Location 10:129765667-129765689
Sequence GAGATGGTCAGCCCCTGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 228}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076343517_1076343526 16 Left 1076343517 10:129765667-129765689 CCAAGGCAGGGGCTGACCATCTC 0: 1
1: 0
2: 1
3: 25
4: 228
Right 1076343526 10:129765706-129765728 CCCCGAACCCTGGGGCAGGCAGG No data
1076343517_1076343523 8 Left 1076343517 10:129765667-129765689 CCAAGGCAGGGGCTGACCATCTC 0: 1
1: 0
2: 1
3: 25
4: 228
Right 1076343523 10:129765698-129765720 TCAGGGCGCCCCGAACCCTGGGG No data
1076343517_1076343521 6 Left 1076343517 10:129765667-129765689 CCAAGGCAGGGGCTGACCATCTC 0: 1
1: 0
2: 1
3: 25
4: 228
Right 1076343521 10:129765696-129765718 GATCAGGGCGCCCCGAACCCTGG No data
1076343517_1076343518 -10 Left 1076343517 10:129765667-129765689 CCAAGGCAGGGGCTGACCATCTC 0: 1
1: 0
2: 1
3: 25
4: 228
Right 1076343518 10:129765680-129765702 TGACCATCTCAGAAGAGATCAGG No data
1076343517_1076343522 7 Left 1076343517 10:129765667-129765689 CCAAGGCAGGGGCTGACCATCTC 0: 1
1: 0
2: 1
3: 25
4: 228
Right 1076343522 10:129765697-129765719 ATCAGGGCGCCCCGAACCCTGGG No data
1076343517_1076343519 -9 Left 1076343517 10:129765667-129765689 CCAAGGCAGGGGCTGACCATCTC 0: 1
1: 0
2: 1
3: 25
4: 228
Right 1076343519 10:129765681-129765703 GACCATCTCAGAAGAGATCAGGG No data
1076343517_1076343531 27 Left 1076343517 10:129765667-129765689 CCAAGGCAGGGGCTGACCATCTC 0: 1
1: 0
2: 1
3: 25
4: 228
Right 1076343531 10:129765717-129765739 GGGGCAGGCAGGTCACCTGCAGG No data
1076343517_1076343524 12 Left 1076343517 10:129765667-129765689 CCAAGGCAGGGGCTGACCATCTC 0: 1
1: 0
2: 1
3: 25
4: 228
Right 1076343524 10:129765702-129765724 GGCGCCCCGAACCCTGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076343517 Original CRISPR GAGATGGTCAGCCCCTGCCT TGG (reversed) Intronic
900290947 1:1923350-1923372 GAGAGGGTGAGCCCCTCCCCAGG - Exonic
900345394 1:2208108-2208130 GGGAGGCTCAGCCCCTGCCTGGG + Intronic
900915461 1:5635246-5635268 GAGAGGGTCAGGCCATGTCTAGG - Intergenic
900992407 1:6104127-6104149 GAGCAGGTCAGGCCCTCCCTAGG - Exonic
901637834 1:10678505-10678527 GGGATCTTCAGCCCCGGCCTCGG - Intronic
901644588 1:10709710-10709732 GCACTGCTCAGCCCCTGCCTGGG - Intronic
902535110 1:17115244-17115266 TGGCTGGTCAGCCTCTGCCTTGG + Intronic
902885005 1:19398332-19398354 GAGCTGGTCAGCCTCTGCTGTGG - Intronic
904889569 1:33769299-33769321 GAGTTGTTCAGTCTCTGCCTAGG - Intronic
905493232 1:38361748-38361770 GACAAGCTCAGCCCCTGCCACGG - Intergenic
907220392 1:52903177-52903199 GAGCAGGTCAGGCCCTGCCCAGG - Intronic
907276231 1:53317988-53318010 GAGCTGGCCAGTCCTTGCCTAGG - Intronic
907519021 1:55011192-55011214 GAGATGGTGAGACCCAGGCTTGG + Intergenic
907529253 1:55076944-55076966 GTGATGGTTAACCCCTGCCAGGG - Intronic
912222780 1:107697279-107697301 GAAATGGTAAGGACCTGCCTAGG - Intronic
912796271 1:112695462-112695484 GAGTAGGTCAGCCCCTGAGTTGG - Exonic
912859362 1:113199156-113199178 GAGATGATCAGCCACTACCTGGG + Intergenic
915092985 1:153439476-153439498 GAGATGATCTGCCCCTACCTGGG - Intronic
916213751 1:162378930-162378952 GAGAGTGTCACCTCCTGCCTGGG - Exonic
917665260 1:177220032-177220054 GAGATGGGCAGGCCATGCCCAGG + Intronic
919814563 1:201429464-201429486 GGCATGGGCAGCCCCTGCCCTGG + Intronic
921199629 1:212792396-212792418 GAGATGCGCAGCGCCCGCCTCGG - Intronic
922584609 1:226724163-226724185 GAGATGTTCAGCCCACGCCAAGG + Intronic
922602035 1:226863740-226863762 GAGAGGGCCAGCCACTGCATTGG + Intergenic
923093115 1:230754188-230754210 GAGAGGGAAAGCCCCTGCCCTGG - Intronic
923769867 1:236929152-236929174 AAGATGGTCAGCCTATGACTTGG - Intergenic
1062844462 10:693132-693154 GAGAGGAGCAGCCCCTTCCTCGG + Intergenic
1062960194 10:1567554-1567576 AGGACGGTCAGCCCCTGCCAGGG + Intronic
1063220176 10:3959990-3960012 GAGGTATTCAGCCCCTCCCTGGG + Intergenic
1070289422 10:75104902-75104924 GAGAGAGTCAGGCCCTGCCCTGG + Intronic
1070722756 10:78768162-78768184 GGCCTGGTCAGCCCCTGCTTTGG + Intergenic
1071747256 10:88436172-88436194 GAGAGGGTCAGCCACTGGGTTGG + Intronic
1072446280 10:95501413-95501435 CAGATGGTGATTCCCTGCCTAGG - Intronic
1073422418 10:103434854-103434876 GAGACGGTCAGCCCCTCGTTGGG - Exonic
1074422595 10:113322583-113322605 AAGATGGTGAGCGGCTGCCTGGG + Intergenic
1075642696 10:124076077-124076099 GAGATGGGCTGCCCCTCTCTTGG + Intronic
1075861799 10:125683468-125683490 GACAAGGTCACCCCCAGCCTGGG - Intergenic
1075873669 10:125789266-125789288 GTGATGGTGAGCACCAGCCTGGG - Intronic
1076343517 10:129765667-129765689 GAGATGGTCAGCCCCTGCCTTGG - Intronic
1076857909 10:133126652-133126674 GGGAAGGTCAGCCCCTGCCCTGG + Intronic
1077110452 11:859895-859917 CAGCAAGTCAGCCCCTGCCTCGG + Intronic
1077431517 11:2518154-2518176 CAGCTGGTGGGCCCCTGCCTGGG + Intronic
1078355134 11:10627366-10627388 GAAAGCGCCAGCCCCTGCCTGGG - Intronic
1079105439 11:17569229-17569251 CAGAAGGACATCCCCTGCCTGGG - Exonic
1079144674 11:17840103-17840125 CAGATGGTGAGCCCCTGTCAGGG - Intronic
1079654703 11:22973834-22973856 GAGAGGGGCAGCCACTGTCTTGG - Intergenic
1080232255 11:30030592-30030614 GATATGATCAGCCCTTGTCTTGG - Intergenic
1081929556 11:46859298-46859320 GTTATGGTCAGGCCCTCCCTAGG + Exonic
1083428619 11:62602268-62602290 GAGCCGGGCAGCCCCAGCCTAGG - Exonic
1085087000 11:73675142-73675164 GAAAAGGGCAACCCCTGCCTTGG - Intergenic
1085405154 11:76257285-76257307 GAGCCGTTCAGCACCTGCCTGGG + Intergenic
1088399599 11:109408575-109408597 CAGATGATCTGCCCCTGCCTTGG + Intergenic
1091923499 12:4324460-4324482 GAGATGATCAGTCACTACCTGGG - Intronic
1092854694 12:12662110-12662132 GAGAAGGTCAGCACATGCCATGG + Exonic
1096198950 12:49667376-49667398 GAGTTGGTTAGCACCTGCTTGGG - Intronic
1101790117 12:107918457-107918479 GAGCTGGTCAGCCCTTTCCCAGG + Intergenic
1103417306 12:120751654-120751676 GAGATGGACAGCCCAGGCCTGGG + Intergenic
1104040833 12:125129483-125129505 GAGCTGGCCAGCCTCTGCCTTGG + Intronic
1105002424 12:132699402-132699424 GAGATGGCGAGACCCTGTCTTGG + Intronic
1106005681 13:25768373-25768395 AAGAAGATCAGCCCCTGCATAGG - Intronic
1106029967 13:25991081-25991103 GAGGTGGACAGCCTCTCCCTCGG + Intronic
1106181603 13:27374152-27374174 AAGATGATGAGCTCCTGCCTGGG + Intergenic
1119919091 14:78429591-78429613 AAGATGATCAGCACCTGCTTTGG + Intronic
1120888470 14:89470769-89470791 GAGATTTTCAGCCAATGCCTCGG + Intronic
1121102423 14:91259127-91259149 GCTCTGGTCAGCCTCTGCCTTGG + Intergenic
1121722562 14:96120597-96120619 GTGATGCTCAGCCTCAGCCTGGG - Intergenic
1122961807 14:105097334-105097356 GAGATGCTCAGCCCCTGTCTGGG + Intergenic
1123051602 14:105546826-105546848 GACAGGGTCAGCGCCGGCCTCGG + Intergenic
1123077014 14:105672529-105672551 GACAGGGTCAGCGCCGGCCTCGG + Intergenic
1124825823 15:33094546-33094568 GAGATGATCAGCCACTTACTTGG - Intronic
1125234049 15:37491014-37491036 GAGATGATCGGCCACTACCTGGG + Intergenic
1125501976 15:40245604-40245626 GAGATGGCCAGCTCTTTCCTGGG - Intronic
1125687700 15:41573170-41573192 CTGATGGTCGGCTCCTGCCTGGG + Intronic
1127982060 15:64042567-64042589 AAAATGGTGAGCCTCTGCCTTGG + Intronic
1129271565 15:74421838-74421860 GCCTTGCTCAGCCCCTGCCTGGG - Intronic
1129392278 15:75226400-75226422 GAGATGGTCATCCCAGACCTCGG - Intergenic
1129777769 15:78247976-78247998 GAGAGGTGCAGCCCCTGCCTTGG + Intergenic
1132629476 16:910266-910288 CAGATGAGCAGCCCCTGGCTGGG + Intronic
1132701005 16:1222131-1222153 AAGATGGGGAGCCCCTCCCTGGG + Intronic
1132830050 16:1923581-1923603 GGGGTGGGCAGCCCCAGCCTGGG + Intergenic
1132912380 16:2321135-2321157 GAGCTGAGCAGCTCCTGCCTGGG + Intronic
1133015535 16:2937868-2937890 GAAAGGCTCAGCCCCTGCCCTGG + Intronic
1136152900 16:28364011-28364033 CAGGTGATCACCCCCTGCCTGGG + Intergenic
1136210183 16:28751262-28751284 CAGGTGATCACCCCCTGCCTGGG - Intergenic
1136315585 16:29453129-29453151 GAGTTGATGAGCCCCTACCTGGG + Intronic
1136430162 16:30192471-30192493 GAGTTGATGAGCCCCTACCTGGG + Intergenic
1136923112 16:34347145-34347167 GAGAGGCACAGCCTCTGCCTGGG - Intergenic
1136981461 16:35064661-35064683 GAGAGGCACAGCCTCTGCCTGGG + Intergenic
1138444691 16:57055953-57055975 CAAATAGTCAGCCCCTGCATGGG + Intronic
1141962929 16:87421446-87421468 GAGGAGGTCAGCTCCTGCCGGGG + Intronic
1142485737 17:246737-246759 GAGATGGTGAGGGCCTGCCTGGG + Intronic
1145889962 17:28407365-28407387 GAGGAGGTCAGACCCTGTCTGGG + Intergenic
1145909996 17:28536947-28536969 GAGAGGTTCAGCAACTGCCTGGG + Intronic
1146190145 17:30757986-30758008 GACCTGGTGATCCCCTGCCTCGG + Intergenic
1146335319 17:31964635-31964657 GACCTGGTGATCCCCTGCCTCGG + Intronic
1147454799 17:40530576-40530598 GAGATGGACAGGCACTGCCAAGG - Intergenic
1147667152 17:42155962-42155984 GAGCTGGACAACCTCTGCCTCGG + Intergenic
1147859950 17:43513459-43513481 GAGCTGGTCAATCCCTGTCTTGG - Exonic
1148386651 17:47238858-47238880 GTGATGGTAAGCCCCTGCTTCGG + Intergenic
1148624164 17:49056183-49056205 GAGATGCTCAGCCTCAGCATGGG + Intergenic
1151190518 17:72394634-72394656 GAAATAGGCAGCCCCTCCCTGGG + Intergenic
1151390839 17:73785782-73785804 CACATGGTCAGCCAGTGCCTAGG + Intergenic
1151544394 17:74783680-74783702 GAGATTGCCAACTCCTGCCTTGG - Intronic
1152158365 17:78650121-78650143 CAGATGCGCAGGCCCTGCCTTGG + Intergenic
1152649020 17:81483424-81483446 CCGAGGGACAGCCCCTGCCTGGG + Intergenic
1152830084 17:82491729-82491751 GGGCAAGTCAGCCCCTGCCTGGG - Intergenic
1152891410 17:82883683-82883705 GACCTGGACAGCCCCTGCCCCGG + Intronic
1153713000 18:7819153-7819175 GAGAAGGTGGGCCCCTGGCTTGG + Intronic
1153963231 18:10157884-10157906 GGCATGGTCAGTCCCTCCCTTGG + Intergenic
1155059465 18:22216038-22216060 AGGATGGTCAGACCCTCCCTTGG - Intergenic
1155646423 18:28083806-28083828 GTGATTGTCAGCCCTGGCCTGGG - Intronic
1156460336 18:37318167-37318189 GGGAGGGTCAGCCCCAGCCCTGG - Intronic
1157502444 18:48200985-48201007 TAGATGTTCCGCACCTGCCTGGG - Intronic
1158935863 18:62364109-62364131 CAGAAGGTCAGCCCATCCCTGGG + Intronic
1159536661 18:69723796-69723818 GAGATGGGCAGCCACAGACTTGG + Intronic
1160903381 19:1440352-1440374 GAGATGATCGGCCACTACCTGGG + Exonic
1160981579 19:1818856-1818878 ACAGTGGTCAGCCCCTGCCTGGG + Intronic
1161275243 19:3412661-3412683 GAGATTGTCAGCCCCAGCCAAGG + Intronic
1161398671 19:4058310-4058332 GAGCTGTTCAGCCCCAGCCAAGG + Intronic
1161422687 19:4184508-4184530 GGGATGTTGAGCACCTGCCTTGG - Intronic
1162380772 19:10330415-10330437 GGGATGGTCACTCCCTGCCCTGG + Intronic
1163740239 19:19007293-19007315 GTGATAGTCAGCCCTTGCCCAGG - Intronic
1164628501 19:29745499-29745521 GAGCAAGCCAGCCCCTGCCTGGG + Intergenic
1164739323 19:30564871-30564893 GAGATGCTCCACTCCTGCCTGGG + Intronic
1164788882 19:30959341-30959363 GAGATGGACACCCTCTGCTTTGG - Intergenic
1165371130 19:35406867-35406889 GAGATGGTCAGGGCCTGGCGAGG + Intergenic
1165739336 19:38196143-38196165 GACATGGTCATCCCTGGCCTGGG + Intronic
1166699800 19:44875678-44875700 GACAGGGACAGCCCCTGTCTGGG - Intronic
1168128157 19:54298660-54298682 GAGCAGGTCCTCCCCTGCCTGGG + Intergenic
1168130106 19:54312412-54312434 GAGCAGGTCCTCCCCTGCCTGGG + Intronic
925401851 2:3579828-3579850 GAGATGGTCACTCATTGCCTTGG + Intronic
925716183 2:6786280-6786302 GGGAGGGCCAGCCCCTCCCTAGG + Intergenic
927949628 2:27158885-27158907 GAGGAGCTCAGCCCCGGCCTGGG - Intergenic
927954780 2:27200771-27200793 GAGGAGCTCAGCCCCAGCCTGGG - Intronic
932447541 2:71790228-71790250 GAGATGGACACCCTCTGCCCTGG - Intergenic
933351102 2:81153017-81153039 GAAATTGTTAGCCCCTGCATCGG + Intergenic
933389753 2:81654558-81654580 GAGATGGTTAGGCCTTTCCTGGG + Intergenic
933813575 2:86048435-86048457 GAGATAACCAGTCCCTGCCTTGG - Intronic
933899881 2:86841857-86841879 AGGAAGGTCAGCCCCAGCCTGGG + Intronic
935780678 2:106507368-106507390 AGGAAGGTCAGCCCCAGCCTGGG - Intergenic
936084850 2:109460340-109460362 GAGATGGTCAGCATCCACCTGGG - Intronic
936111702 2:109670575-109670597 GAGGAGAACAGCCCCTGCCTTGG - Intergenic
936514493 2:113173344-113173366 GAGATGCTAAGCCACTGCCCAGG - Intronic
938102343 2:128505629-128505651 GAGGTGCTGAGCCCCTGCCTGGG - Intergenic
941790832 2:169549951-169549973 GACATGGTCAATCCCTGTCTGGG + Intronic
941986634 2:171517358-171517380 GAGATGATCGGCCACTACCTGGG - Intergenic
942041690 2:172071390-172071412 GAGATGCTCATCCCCTTCTTAGG - Intronic
945441495 2:209885345-209885367 GAGCTGTTCAGCCCCTTCTTTGG - Intronic
945786490 2:214245674-214245696 CAGATGGTCAGACACTGCCTTGG - Intronic
948454743 2:238099758-238099780 GAAGGTGTCAGCCCCTGCCTCGG - Intergenic
1170042769 20:12055288-12055310 GAGATCCTAAGGCCCTGCCTGGG + Intergenic
1170571433 20:17634957-17634979 GCTGTGGTCAGCCCCTGCCTTGG + Intronic
1171370762 20:24660840-24660862 GAGATGACCAGCCCCTGGCTGGG - Intronic
1172759948 20:37314820-37314842 GGGAAGGGCAGTCCCTGCCTCGG - Intronic
1176019774 20:62956731-62956753 GAGATGGTCAGGCCCTGGGGAGG - Intronic
1177134706 21:17296756-17296778 AAGAGGGTCAGCCCTTCCCTGGG + Intergenic
1178473840 21:32918997-32919019 GTGCTGTTCAGGCCCTGCCTCGG - Intergenic
1180200524 21:46221136-46221158 GAGGTGGACAGCCCCGGGCTTGG + Intronic
1180200532 21:46221160-46221182 GAGGTGGACAGCCCCGGGCTTGG + Intronic
1180200540 21:46221184-46221206 GAGGTGGACAGCCCCGGGCTTGG + Intronic
1181306584 22:21920558-21920580 GAGCTGCTCCGCCCTTGCCTTGG - Exonic
1181360075 22:22327557-22327579 GAGATGGTGACCCTCTGCCCTGG - Intergenic
1181362589 22:22349524-22349546 GGGATGTTCAGCTCCTGCCCAGG + Intergenic
1181363743 22:22358006-22358028 GAGATGGTGACCCTCTGCCCGGG - Intergenic
1181366557 22:22381091-22381113 GAGATGGTGACCCTCTGCCCGGG - Intergenic
1181370298 22:22410023-22410045 GAGATGGTGACCCTCTGCCCTGG - Intergenic
1181372922 22:22432209-22432231 GAGATGGTGACCCTCTGCCTGGG - Intergenic
1181977685 22:26742614-26742636 CAAATGATCCGCCCCTGCCTCGG - Intergenic
1182070835 22:27462575-27462597 GAGATGTGCAGCCCCTGCGCAGG + Intergenic
1183287035 22:36973288-36973310 GAGATGCCCAGCCCCTCCCTTGG - Intergenic
952219567 3:31311756-31311778 GAAATTGTCTGCCCCTGTCTTGG - Intergenic
953208249 3:40851209-40851231 GTGATGGTCACCCCGGGCCTAGG - Intergenic
954442946 3:50531612-50531634 GGGATGGGCAGCACCAGCCTTGG - Intergenic
954611631 3:51947420-51947442 GACATCATCAGCCCCTACCTGGG - Intronic
954817586 3:53294858-53294880 GAGAAAGAGAGCCCCTGCCTTGG - Intronic
956171816 3:66438889-66438911 GAGATGTGCATTCCCTGCCTTGG - Intronic
956191174 3:66610016-66610038 GAGATGATCAGCCTCTGCGGGGG + Intergenic
956332336 3:68125515-68125537 GAGAGACACAGCCCCTGCCTGGG + Intronic
959537532 3:107503508-107503530 GAGGTGGCCAGCAACTGCCTTGG + Intergenic
959670889 3:108976197-108976219 GAGATGGCCAGACACTACCTTGG + Intronic
961453344 3:127012485-127012507 CTGATGATCAGCCCATGCCTGGG - Intronic
965899382 3:173619811-173619833 GAGATGTCCATTCCCTGCCTTGG - Intronic
968487592 4:871333-871355 GTGAGGGCCAGCGCCTGCCTTGG - Intronic
969104825 4:4797759-4797781 GAGATGGTCAAGTGCTGCCTAGG - Intergenic
969469659 4:7380156-7380178 GACGTGCTCAGCCCCAGCCTGGG + Intronic
976313597 4:83636528-83636550 CAGGTGATCCGCCCCTGCCTTGG + Intergenic
976328745 4:83803345-83803367 GAGATGGTCAGCACCTGGCCTGG + Intergenic
978417208 4:108489103-108489125 GAAATGGTCTGACCCTGCTTTGG - Intergenic
980992024 4:139746565-139746587 GAGATTTGCAGCCCCTCCCTGGG - Intronic
981027445 4:140091310-140091332 GAGAAGCTCAGCCCCTCTCTTGG - Intronic
984987972 4:185350077-185350099 GAGGTGGGCAGGCCCTGCCATGG - Intronic
985676129 5:1232186-1232208 GGGGTGGTCAGCACCTGCCCAGG - Intronic
986597632 5:9440037-9440059 CTGAGGGTCAGCCCTTGCCTGGG + Intronic
987418637 5:17692138-17692160 AAGATGGTGAGCCCCAGCTTGGG + Intergenic
994820568 5:104645580-104645602 GAGATGGTCAGCTCTTGGGTGGG - Intergenic
1001759953 5:174199002-174199024 GATCTCTTCAGCCCCTGCCTGGG + Intronic
1002099150 5:176848788-176848810 AAGATGGGCAGCCGCGGCCTGGG + Intronic
1002101172 5:176858394-176858416 GAGGTGGGAAGCTCCTGCCTCGG + Intronic
1003015501 6:2464281-2464303 CAAATGGTCAGCTCCTGCCGAGG - Intergenic
1003843715 6:10150189-10150211 GAGAATGTCAGCCCCAGCCCTGG - Intronic
1004247916 6:13997960-13997982 GAGATGTTCAGCCCACTCCTAGG + Intergenic
1004858914 6:19781251-19781273 GACATGTTCAGGCCCTGCTTGGG + Intergenic
1006840842 6:37027118-37027140 GAGATGCTCAGCCCCTTCTCAGG + Intronic
1006922436 6:37635591-37635613 GAGATGGGCAGCCTTTGCCTCGG + Exonic
1007075801 6:39065458-39065480 GAGCTGAGGAGCCCCTGCCTTGG + Intronic
1007105312 6:39279691-39279713 GAGCAGGTCAGCCACTGCCATGG + Intergenic
1007112606 6:39321695-39321717 GAGTGGGTCACCCCCTGCCTGGG - Intronic
1010462935 6:76133861-76133883 GGGATGGACAGCACCTGCATGGG + Intergenic
1010892386 6:81329736-81329758 GAGATGGTCATCTCCTGCCAGGG + Intergenic
1013472614 6:110477961-110477983 AGGAAGGTCACCCCCTGCCTGGG - Intergenic
1017141759 6:151197129-151197151 GACATGGCCTGGCCCTGCCTAGG - Intergenic
1024803703 7:53111161-53111183 GATTTGGTCAGCCCCTGTCTTGG - Intergenic
1025161060 7:56661258-56661280 GTGATTGTCATCTCCTGCCTGGG + Intergenic
1026450586 7:70525828-70525850 GAGATGGGCACCTCCAGCCTTGG + Intronic
1029147940 7:98459705-98459727 CCTATGGTCAGCCCCTGCCACGG - Intergenic
1029422230 7:100477632-100477654 GAGCTGGCCAGCCTCGGCCTGGG - Exonic
1031396863 7:121284731-121284753 GAGGTGGTCTCCCCCAGCCTTGG + Intronic
1034968281 7:155404601-155404623 GAGGTGGGCAGCCCCTGCTGGGG + Intergenic
1035152332 7:156885115-156885137 CAGGTGATCCGCCCCTGCCTCGG - Intronic
1035155444 7:156908533-156908555 CAGGTGATCAGCCCCCGCCTCGG - Intergenic
1035238924 7:157517540-157517562 GTGATGGTCAGCCAGTGCCTGGG + Intergenic
1035247536 7:157573645-157573667 TAGCTGGTCAGCTCCTGCTTTGG + Intronic
1035468684 7:159096227-159096249 GAGAGTTTCAACCCCTGCCTGGG + Intronic
1037547779 8:19940247-19940269 GGGAGGGTCAGCCCCTCGCTGGG - Intronic
1039836350 8:41259206-41259228 GAGAAGATCAGCCCCAGCTTTGG + Intergenic
1040951824 8:52945072-52945094 AAGATGGTGAGCCGCTCCCTGGG - Intergenic
1041480193 8:58311572-58311594 GAGATGGGGAGCCACTGCATGGG - Intergenic
1045295730 8:100870398-100870420 GAGGTGGGCAGCCTTTGCCTGGG - Intergenic
1048572861 8:135669486-135669508 CAGCTGTTCAGCCCCTTCCTTGG - Intergenic
1048884127 8:138895126-138895148 TAGATGTTCAGCTCCTGGCTGGG - Intronic
1049426124 8:142538630-142538652 GAGAAGGACAGCCCCAGGCTTGG + Intronic
1049720924 8:144115142-144115164 GGGAGTGGCAGCCCCTGCCTTGG + Intronic
1053469958 9:38339390-38339412 GAGGCTGTCAGCTCCTGCCTTGG - Intergenic
1053474938 9:38375850-38375872 GAGAGAATCAGCCCCAGCCTGGG - Intergenic
1053489348 9:38487680-38487702 GTGGTGGTCAGCCCCCGTCTGGG + Intergenic
1054938681 9:70716115-70716137 GAGATTGCCACCCCCTTCCTCGG - Intronic
1054940372 9:70734108-70734130 GAGATTGCCACCCCCTTCCTCGG - Intronic
1057147416 9:92767655-92767677 GCCATGGTCAGTCCCTGCGTGGG - Intergenic
1057222945 9:93267596-93267618 GAGCTGTCCAGCCCCTGTCTTGG + Intronic
1057341447 9:94205507-94205529 GACCTGGTGATCCCCTGCCTCGG - Intergenic
1057913174 9:99035817-99035839 GAGATGGACAACACCTGCCAGGG - Intronic
1059384502 9:113953815-113953837 CAGAGGCACAGCCCCTGCCTGGG + Intronic
1060280901 9:122214663-122214685 GAGAAGGAAAGCCCCTGCCCTGG + Intronic
1060990337 9:127845333-127845355 GAGATGGTCACCCCTTGCCATGG + Intronic
1061069020 9:128297222-128297244 GAAATGATCAGCCTCTGCCTTGG + Intergenic
1061118709 9:128630102-128630124 GAGATGGGAAGCTGCTGCCTTGG - Intronic
1062285767 9:135771882-135771904 CATAGGGTCAGCCTCTGCCTGGG - Intronic
1062600079 9:137315596-137315618 GGGATGGTCAGCCCCCACCCCGG + Intronic
1185789194 X:2915789-2915811 CAGAAGGTGATCCCCTGCCTTGG - Intronic
1187182394 X:16955327-16955349 GGGATGGTCACCCCCTCTCTTGG + Intronic
1192368143 X:70492147-70492169 GAGAAGCTGAGCCCCTGGCTTGG - Exonic
1198870921 X:141176675-141176697 GAGATGGATAGCCCCATCCTAGG - Exonic
1199252734 X:145682705-145682727 GAGATGCACAGCCCAGGCCTTGG - Intergenic
1199653909 X:149975653-149975675 GAGCTGCTCAGCCTCTCCCTGGG - Intergenic
1201285800 Y:12377567-12377589 CAGAAGGTGATCCCCTGCCTTGG + Intergenic