ID: 1076345142

View in Genome Browser
Species Human (GRCh38)
Location 10:129774494-129774516
Sequence GCTCCCCCGCCCCCCAGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076345133_1076345142 29 Left 1076345133 10:129774442-129774464 CCTCTCTCATTGCTGATGGGTGA No data
Right 1076345142 10:129774494-129774516 GCTCCCCCGCCCCCCAGGCCAGG No data
1076345137_1076345142 0 Left 1076345137 10:129774471-129774493 CCCTTGGGACAGAAGGACCCTGT No data
Right 1076345142 10:129774494-129774516 GCTCCCCCGCCCCCCAGGCCAGG No data
1076345138_1076345142 -1 Left 1076345138 10:129774472-129774494 CCTTGGGACAGAAGGACCCTGTG No data
Right 1076345142 10:129774494-129774516 GCTCCCCCGCCCCCCAGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076345142 Original CRISPR GCTCCCCCGCCCCCCAGGCC AGG Intergenic
No off target data available for this crispr