ID: 1076346338

View in Genome Browser
Species Human (GRCh38)
Location 10:129781255-129781277
Sequence CCTCACCTGCAGAACAGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076346326_1076346338 26 Left 1076346326 10:129781206-129781228 CCCCAGTTGGTGGAATTTGTTGC No data
Right 1076346338 10:129781255-129781277 CCTCACCTGCAGAACAGGGATGG No data
1076346325_1076346338 27 Left 1076346325 10:129781205-129781227 CCCCCAGTTGGTGGAATTTGTTG No data
Right 1076346338 10:129781255-129781277 CCTCACCTGCAGAACAGGGATGG No data
1076346330_1076346338 -2 Left 1076346330 10:129781234-129781256 CCCCAGGAGCTCCTGCAGCCACC No data
Right 1076346338 10:129781255-129781277 CCTCACCTGCAGAACAGGGATGG No data
1076346332_1076346338 -4 Left 1076346332 10:129781236-129781258 CCAGGAGCTCCTGCAGCCACCTC No data
Right 1076346338 10:129781255-129781277 CCTCACCTGCAGAACAGGGATGG No data
1076346327_1076346338 25 Left 1076346327 10:129781207-129781229 CCCAGTTGGTGGAATTTGTTGCA No data
Right 1076346338 10:129781255-129781277 CCTCACCTGCAGAACAGGGATGG No data
1076346331_1076346338 -3 Left 1076346331 10:129781235-129781257 CCCAGGAGCTCCTGCAGCCACCT No data
Right 1076346338 10:129781255-129781277 CCTCACCTGCAGAACAGGGATGG No data
1076346324_1076346338 28 Left 1076346324 10:129781204-129781226 CCCCCCAGTTGGTGGAATTTGTT No data
Right 1076346338 10:129781255-129781277 CCTCACCTGCAGAACAGGGATGG No data
1076346328_1076346338 24 Left 1076346328 10:129781208-129781230 CCAGTTGGTGGAATTTGTTGCAG No data
Right 1076346338 10:129781255-129781277 CCTCACCTGCAGAACAGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076346338 Original CRISPR CCTCACCTGCAGAACAGGGA TGG Intergenic
No off target data available for this crispr