ID: 1076349189

View in Genome Browser
Species Human (GRCh38)
Location 10:129803245-129803267
Sequence ACTCCTACAACTCAATAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076349189_1076349193 23 Left 1076349189 10:129803245-129803267 CCTCCTTATTGAGTTGTAGGAGT No data
Right 1076349193 10:129803291-129803313 CTCTGTCAGTTCTACATGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076349189 Original CRISPR ACTCCTACAACTCAATAAGG AGG (reversed) Intergenic
No off target data available for this crispr