ID: 1076349190

View in Genome Browser
Species Human (GRCh38)
Location 10:129803248-129803270
Sequence AGAACTCCTACAACTCAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076349190_1076349193 20 Left 1076349190 10:129803248-129803270 CCTTATTGAGTTGTAGGAGTTCT No data
Right 1076349193 10:129803291-129803313 CTCTGTCAGTTCTACATGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076349190 Original CRISPR AGAACTCCTACAACTCAATA AGG (reversed) Intergenic
No off target data available for this crispr