ID: 1076351114

View in Genome Browser
Species Human (GRCh38)
Location 10:129815924-129815946
Sequence CACCCCCTCCCCTCTGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076351103_1076351114 4 Left 1076351103 10:129815897-129815919 CCCACCCTACATCTCCCGGGAAG No data
Right 1076351114 10:129815924-129815946 CACCCCCTCCCCTCTGGGGTGGG No data
1076351106_1076351114 -1 Left 1076351106 10:129815902-129815924 CCTACATCTCCCGGGAAGCCAGC No data
Right 1076351114 10:129815924-129815946 CACCCCCTCCCCTCTGGGGTGGG No data
1076351100_1076351114 26 Left 1076351100 10:129815875-129815897 CCTGTGTTGAATGATGGTCACAC No data
Right 1076351114 10:129815924-129815946 CACCCCCTCCCCTCTGGGGTGGG No data
1076351105_1076351114 0 Left 1076351105 10:129815901-129815923 CCCTACATCTCCCGGGAAGCCAG No data
Right 1076351114 10:129815924-129815946 CACCCCCTCCCCTCTGGGGTGGG No data
1076351107_1076351114 -10 Left 1076351107 10:129815911-129815933 CCCGGGAAGCCAGCACCCCCTCC No data
Right 1076351114 10:129815924-129815946 CACCCCCTCCCCTCTGGGGTGGG No data
1076351104_1076351114 3 Left 1076351104 10:129815898-129815920 CCACCCTACATCTCCCGGGAAGC No data
Right 1076351114 10:129815924-129815946 CACCCCCTCCCCTCTGGGGTGGG No data
1076351099_1076351114 27 Left 1076351099 10:129815874-129815896 CCCTGTGTTGAATGATGGTCACA No data
Right 1076351114 10:129815924-129815946 CACCCCCTCCCCTCTGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076351114 Original CRISPR CACCCCCTCCCCTCTGGGGT GGG Intergenic
No off target data available for this crispr