ID: 1076351196

View in Genome Browser
Species Human (GRCh38)
Location 10:129816200-129816222
Sequence CCTGGTGCACAGAGGCCTCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076351196_1076351203 5 Left 1076351196 10:129816200-129816222 CCGAGAGGCCTCTGTGCACCAGG No data
Right 1076351203 10:129816228-129816250 CCTAGAAAGGTCTGGCCTTGTGG No data
1076351196_1076351206 8 Left 1076351196 10:129816200-129816222 CCGAGAGGCCTCTGTGCACCAGG No data
Right 1076351206 10:129816231-129816253 AGAAAGGTCTGGCCTTGTGGGGG No data
1076351196_1076351205 7 Left 1076351196 10:129816200-129816222 CCGAGAGGCCTCTGTGCACCAGG No data
Right 1076351205 10:129816230-129816252 TAGAAAGGTCTGGCCTTGTGGGG No data
1076351196_1076351208 29 Left 1076351196 10:129816200-129816222 CCGAGAGGCCTCTGTGCACCAGG No data
Right 1076351208 10:129816252-129816274 GGTTCTACTGCACCCCTGCCTGG No data
1076351196_1076351204 6 Left 1076351196 10:129816200-129816222 CCGAGAGGCCTCTGTGCACCAGG No data
Right 1076351204 10:129816229-129816251 CTAGAAAGGTCTGGCCTTGTGGG No data
1076351196_1076351201 -3 Left 1076351196 10:129816200-129816222 CCGAGAGGCCTCTGTGCACCAGG No data
Right 1076351201 10:129816220-129816242 AGGCACAGCCTAGAAAGGTCTGG No data
1076351196_1076351199 -8 Left 1076351196 10:129816200-129816222 CCGAGAGGCCTCTGTGCACCAGG No data
Right 1076351199 10:129816215-129816237 GCACCAGGCACAGCCTAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076351196 Original CRISPR CCTGGTGCACAGAGGCCTCT CGG (reversed) Intergenic
No off target data available for this crispr