ID: 1076353950

View in Genome Browser
Species Human (GRCh38)
Location 10:129838999-129839021
Sequence GCCCCCGAAGTGCCGCCGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 33}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076353950_1076353954 3 Left 1076353950 10:129838999-129839021 CCAGTCGGCGGCACTTCGGGGGC 0: 1
1: 0
2: 1
3: 3
4: 33
Right 1076353954 10:129839025-129839047 GGCGTCCCTTCATACGCTAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076353950 Original CRISPR GCCCCCGAAGTGCCGCCGAC TGG (reversed) Intronic
900427482 1:2587137-2587159 GCACCCGAAGCGCCGCAGCCCGG - Exonic
922800520 1:228362728-228362750 GCCTCCGAAGTTCCGGTGACTGG - Exonic
1062841614 10:677833-677855 CCCCCAGAAGTGCCACAGACAGG + Intronic
1073035584 10:100562473-100562495 GCCCCCGACCTTCCGCCGACTGG + Intergenic
1074115091 10:110450901-110450923 GCCCCCAAAATGCCACCGTCTGG + Intergenic
1076353950 10:129838999-129839021 GCCCCCGAAGTGCCGCCGACTGG - Intronic
1076781538 10:132727486-132727508 GGCGCCGAGGTGCCACCGACAGG + Intronic
1077152205 11:1077432-1077454 GACCCCGATGTGCCTCCGCCAGG + Intergenic
1083638405 11:64132550-64132572 GACCCCGAGGAGCCGCTGACTGG - Intronic
1138196568 16:55056788-55056810 GCCCCAGAACTGCCGCCGGCCGG + Intergenic
1140354908 16:74297176-74297198 GGCCCCGAAGTGGCGGCGGCTGG - Intronic
1142416863 16:89948045-89948067 GCCTCCGAAGTCCCGCTGCCCGG + Intronic
1143495147 17:7308231-7308253 GCACCGGAAGTGCCCCCCACGGG + Intronic
1150168453 17:62966530-62966552 GCCCCCGAGCCGCCGCTGACAGG + Intergenic
1155161955 18:23203254-23203276 GCCCTGGAAGTGCCGCCTCCTGG + Intronic
1161684524 19:5696317-5696339 GCTCCAGCAGTGCCGACGACGGG + Exonic
1164146794 19:22517596-22517618 GCCCAGGAACTGCCGCCGACCGG + Intronic
1168255452 19:55162119-55162141 GCCCTCAAGGTGCCGCCGCCCGG - Exonic
942928176 2:181457683-181457705 GCCCCCGAAGGGCCGCCGTCCGG + Exonic
1168855024 20:1002226-1002248 GCGCCCGCCGTGCCGCCGCCGGG - Exonic
1184664190 22:45978731-45978753 GCTCCCTCAGTGCCGCCGCCGGG - Intergenic
955769592 3:62374057-62374079 GCCCCCGAGATGCCGGCGAGCGG - Intronic
966846600 3:184135392-184135414 GCCCCTGTAGTGGCGCCGCCTGG + Exonic
968775168 4:2536124-2536146 GCCGCCCAGGTGCCGCAGACCGG - Intronic
987112520 5:14701065-14701087 GCCCAGGAAGGGCGGCCGACAGG - Intergenic
988949357 5:36241723-36241745 GTCCCCGCAGCGCCGCCGCCCGG + Exonic
1020278235 7:6637306-6637328 GCACCGGAAGTACCGCCGGCCGG - Exonic
1033394150 7:140957414-140957436 GCTCCTCAAGTGCCGCCGAATGG + Intergenic
1061793573 9:133071270-133071292 GCCCCCCCCGTGCCGCCCACGGG + Exonic
1061793589 9:133071303-133071325 GCCCCCCCCGTGCCGCCCACGGG + Exonic
1061793605 9:133071336-133071358 GCCCCCCCCGTGCCGCCCACGGG + Exonic
1061793621 9:133071369-133071391 GCCCCCCCCGTGCCGCCCACGGG + Exonic
1061793637 9:133071402-133071424 GCCCCCCCCGTGCCGCCCACGGG + Exonic
1061793653 9:133071435-133071457 GCCCCCCCCGTGCCGCCCACGGG + Exonic
1061793669 9:133071468-133071490 GCCCCCCCCGTGCCGCCCACGGG + Exonic
1061793683 9:133071501-133071523 GCCCCCCCCGTGCCGCCCACGGG + Exonic
1061793713 9:133071567-133071589 GCCCCCCCCGTGCCGCCCACGGG + Exonic
1062584144 9:137241508-137241530 GCCCCCGCATTGCGGCCGCCGGG + Intronic