ID: 1076354017

View in Genome Browser
Species Human (GRCh38)
Location 10:129839459-129839481
Sequence CCCTGTGCCTGCCCAGCGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 856
Summary {0: 1, 1: 1, 2: 7, 3: 79, 4: 768}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076354017_1076354028 22 Left 1076354017 10:129839459-129839481 CCAGGCGCTGGGCAGGCACAGGG 0: 1
1: 1
2: 7
3: 79
4: 768
Right 1076354028 10:129839504-129839526 CTGTGGACAGCTGTGCCCTCGGG No data
1076354017_1076354027 21 Left 1076354017 10:129839459-129839481 CCAGGCGCTGGGCAGGCACAGGG 0: 1
1: 1
2: 7
3: 79
4: 768
Right 1076354027 10:129839503-129839525 TCTGTGGACAGCTGTGCCCTCGG No data
1076354017_1076354029 23 Left 1076354017 10:129839459-129839481 CCAGGCGCTGGGCAGGCACAGGG 0: 1
1: 1
2: 7
3: 79
4: 768
Right 1076354029 10:129839505-129839527 TGTGGACAGCTGTGCCCTCGGGG No data
1076354017_1076354030 27 Left 1076354017 10:129839459-129839481 CCAGGCGCTGGGCAGGCACAGGG 0: 1
1: 1
2: 7
3: 79
4: 768
Right 1076354030 10:129839509-129839531 GACAGCTGTGCCCTCGGGGCCGG No data
1076354017_1076354019 -7 Left 1076354017 10:129839459-129839481 CCAGGCGCTGGGCAGGCACAGGG 0: 1
1: 1
2: 7
3: 79
4: 768
Right 1076354019 10:129839475-129839497 CACAGGGTGCCCACCCCGTGTGG No data
1076354017_1076354022 5 Left 1076354017 10:129839459-129839481 CCAGGCGCTGGGCAGGCACAGGG 0: 1
1: 1
2: 7
3: 79
4: 768
Right 1076354022 10:129839487-129839509 ACCCCGTGTGGCCTCATCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076354017 Original CRISPR CCCTGTGCCTGCCCAGCGCC TGG (reversed) Intronic
900086045 1:897781-897803 CCCAGTGACTGAGCAGCGCCTGG - Intergenic
900164246 1:1238363-1238385 GCCTGTGCCTGCCGAGCCACCGG - Intergenic
900172168 1:1274365-1274387 GCAGGTGCCTGCCCAGCCCCGGG + Intergenic
900246525 1:1638671-1638693 CCCTGCACCTGCCCCGTGCCGGG - Intronic
900368330 1:2320494-2320516 CCCTCTGCCCGCCCAGCGCTGGG - Intergenic
900393468 1:2443695-2443717 CCCCCTGCCCGCCCCGCGCCGGG - Intronic
900430296 1:2598179-2598201 CCCCTTCCCTGCCCAGAGCCTGG - Intronic
900591231 1:3460926-3460948 CTCTGTCCCTGCTCAGCCCCGGG - Intronic
900596760 1:3483486-3483508 CTCTGTGCCCGCCCAGGGCTGGG - Intergenic
900607253 1:3529374-3529396 CACTGTCCCTGTCCAGCCCCAGG + Intronic
900618452 1:3576158-3576180 TGCAGGGCCTGCCCAGCGCCGGG + Intronic
900618878 1:3577951-3577973 CCCTGTGCCTGCCGATGCCCCGG + Intronic
901446091 1:9308967-9308989 CCTGGTGCCCGCCCAGCCCCTGG - Intronic
901693664 1:10990810-10990832 CCCAGGGCCTTCCCAGCACCTGG - Intergenic
902070253 1:13728522-13728544 CCCTGGGGCTGCCCAGCGTCTGG + Intronic
902531687 1:17094641-17094663 CCCTGGGCCTGACCCGCTCCTGG + Intronic
902673519 1:17992584-17992606 CTGTGTGCCAGCCCAGGGCCAGG + Intergenic
902801969 1:18836106-18836128 TCCTGTGGCTCCCCAGTGCCTGG - Intergenic
902802942 1:18841668-18841690 CCCTGCCCCTGCCCTGCCCCTGG - Intronic
902807233 1:18868748-18868770 CCCAGCGCCTGTCCAGCTCCAGG + Intronic
903225363 1:21891516-21891538 CCCAGTGCCTGCCGCGTGCCTGG + Intronic
903581753 1:24376307-24376329 CACTGTGCCTGGCCTGCACCTGG + Intronic
904004516 1:27356831-27356853 CCTGGGGCCTGCCCAGAGCCGGG - Intronic
905019458 1:34798373-34798395 CCCCGTGCCTGACCAGTGCTTGG - Intronic
905182938 1:36177931-36177953 CCCTGCCCCAGCCCAGGGCCAGG + Exonic
906731975 1:48090145-48090167 CCCTGTGCCCACCCAGGGCCCGG + Intergenic
906769583 1:48472069-48472091 CCCCGTCCCCGCCCAGCCCCAGG - Exonic
907266635 1:53265755-53265777 CTCAGTGTCTACCCAGCGCCTGG + Intronic
907396725 1:54195788-54195810 CCCAGTGCTTGCACAGAGCCTGG - Intronic
907404522 1:54245681-54245703 CCCTGTGGCTGCTCAGGGCATGG + Intronic
907920812 1:58910105-58910127 CCCTGTGCCAGCAGAGGGCCTGG - Intergenic
908861980 1:68499421-68499443 CCCAGTACCAGCCCAGAGCCTGG + Intergenic
908981806 1:69967645-69967667 CCCAGTCCCAGCCCAGAGCCTGG + Intronic
909309663 1:74130142-74130164 CTCTGAGCCAGCCCAGCACCAGG + Intronic
909378950 1:74974897-74974919 CACTGTGCCTTTCCAGCACCAGG + Intergenic
910550326 1:88467334-88467356 GCCTGAGCCTCCCCAGCCCCCGG + Intergenic
910673178 1:89793565-89793587 ACCTGCCCCTGCCCAGCCCCTGG - Intronic
911317937 1:96376984-96377006 CCCAGTACCAGCCCAGAGCCTGG + Intergenic
911562107 1:99418430-99418452 CCCAGTGCCAGCCCAGAGTCTGG + Intergenic
912022035 1:105117525-105117547 CCCAGTGCCAGCCCAGAGCCTGG + Intergenic
912416048 1:109509126-109509148 CCCACTGCCTGCACAGTGCCTGG - Intronic
912745651 1:112243462-112243484 CCCTGGACCAGCCCAGAGCCAGG - Intergenic
912776208 1:112508019-112508041 CCCTCCGCCCGCACAGCGCCTGG - Intronic
912933010 1:113981159-113981181 CCCTGTGCCTACCCAGGGGAAGG - Exonic
913089401 1:115466304-115466326 CCCTGTGGCAGCCCACAGCCAGG + Intergenic
913151432 1:116047573-116047595 CCCAGTTCCAGCCCAGAGCCAGG + Intronic
914313640 1:146488502-146488524 CTCTTTGCCTTCCCATCGCCTGG - Intergenic
914500709 1:148244880-148244902 CTCTTTGCCTTCCCATCGCCTGG + Intergenic
914859422 1:151373911-151373933 CCCTGTGGCTGCCCGGGGCAAGG + Intergenic
914991519 1:152503058-152503080 ACCTATGCCTGCCCAGCTCTGGG - Intergenic
915138509 1:153751167-153751189 CCATGGGACTGCCCAGCTCCAGG + Exonic
915525299 1:156472365-156472387 CCATGTGTGTGCCCAGCCCCAGG - Intronic
915557117 1:156666974-156666996 CCCAGTGCCTGCACAGCGCATGG + Intergenic
916037194 1:160932774-160932796 GCCTCAGCCTGCCCAGTGCCTGG + Intergenic
916839386 1:168584257-168584279 CCATGTACCTGCTCAGCCCCTGG + Intergenic
917591360 1:176480250-176480272 CTCTATGCCTCCCCAGCTCCTGG + Intronic
917602672 1:176593725-176593747 CCCTGGGCCTGCCCTGAGCAAGG + Intronic
919397577 1:197069817-197069839 CCCAGTACCAGCCCAGAGCCTGG + Intergenic
919802164 1:201360589-201360611 GCCTGAGCCTGCCCAGCGAGGGG + Intronic
919912936 1:202123044-202123066 CTCTGTGCCTGCCCAGGTGCAGG - Exonic
920192389 1:204201883-204201905 TCCTGTCCCAGCCCACCGCCTGG - Intronic
920262086 1:204695473-204695495 CCAGGTGCCTGCCCTGTGCCAGG - Intergenic
920398756 1:205664257-205664279 CCCTGGTCCTGCACAGAGCCTGG - Intronic
920509862 1:206542921-206542943 CACTGTGCCTGGCTAGTGCCTGG - Intronic
921409730 1:214823161-214823183 CCCAGTACCAGCCCAGAGCCGGG - Intergenic
921762818 1:218936917-218936939 CCCAGTACCAGCCCAGAGCCTGG - Intergenic
922143071 1:222909760-222909782 CTCTGAGCCTGCCAAGCTCCTGG + Intronic
922180291 1:223227992-223228014 GCCTGTGCCAGGCCTGCGCCTGG - Intronic
922705647 1:227788751-227788773 TCCGCAGCCTGCCCAGCGCCGGG + Intergenic
922784330 1:228275656-228275678 CCCGGCGCCTGCCCTGAGCCGGG - Intronic
922801192 1:228365450-228365472 CCCTGTGCCTGCCCCGGGCCAGG - Exonic
922813023 1:228428625-228428647 CCCTGAGCCTGGCCTGCTCCAGG - Intergenic
923490325 1:234478575-234478597 CCCCGCCCCCGCCCAGCGCCAGG + Exonic
924321349 1:242854450-242854472 CCCAGTGCCAGCCCAGAGCCTGG - Intergenic
924823999 1:247521493-247521515 GCCTTAGCCTGCCCAGTGCCTGG + Intronic
1063639876 10:7818763-7818785 CCGAGTCCCAGCCCAGCGCCTGG - Exonic
1064018996 10:11794327-11794349 CCCTGTCCCTTCCCAGCACTGGG + Intergenic
1064084536 10:12335443-12335465 CCCTGTGCCTGGCCAGCATTTGG - Intergenic
1065501952 10:26391804-26391826 GCCTGGGCCTGCCCAGGACCGGG - Intergenic
1066010333 10:31188550-31188572 CCAAGTGCCTGCCCTGGGCCAGG + Intergenic
1066064214 10:31750505-31750527 CCCAGCGGCTGCCCAGGGCCGGG - Intergenic
1066649648 10:37642458-37642480 CTCTGGACCTGCCCAGGGCCTGG - Intergenic
1067061581 10:43080605-43080627 CCCTGAGCCTGCCCACCCACTGG + Intronic
1067063515 10:43090248-43090270 CCCTGTGTCTTCCCTGCACCTGG - Intronic
1067213232 10:44279061-44279083 CCCTGAGCATCCCCAGAGCCTGG - Intergenic
1067529966 10:47063159-47063181 CCCTTTGCCTTCCCTGCGCTGGG + Intergenic
1067945513 10:50685969-50685991 CCCTGTGGGTTCCCAGAGCCTGG - Intergenic
1068480838 10:57586120-57586142 CCCAGTACCAGCCCAGAGCCAGG + Intergenic
1069621742 10:69841407-69841429 CTCTGTGTCTTCCCAGCACCTGG + Intronic
1069755024 10:70769191-70769213 GCCTCTGCCTGGCCTGCGCCAGG - Intergenic
1069853348 10:71424719-71424741 CCCCCAGCCTGCCCAGAGCCTGG - Intronic
1070740919 10:78902711-78902733 CCCTGTGCCAGACCAGCCCTGGG - Intergenic
1070830041 10:79412479-79412501 GCCTGTGGCTGCCCAGTCCCTGG - Intronic
1070867026 10:79712842-79712864 CCCTGTGGGTTCCCAGAGCCTGG - Intronic
1070880816 10:79850963-79850985 CCCTGTGGGTTCCCAGAGCCTGG - Intergenic
1071633938 10:87235065-87235087 CCCTGTGGGTTCCCAGAGCCTGG - Intronic
1071843592 10:89498822-89498844 CCCTGTACCAGCCCGGAGCCTGG + Intronic
1071997679 10:91163324-91163346 CCCCTTGCCCGCCCGGCGCCCGG - Intronic
1072180301 10:92975318-92975340 CCCTCTGCCTGGCAACCGCCCGG + Intronic
1073064485 10:100750116-100750138 CCCAGTGCTTGCCCTGCCCCTGG + Intronic
1073332407 10:102679047-102679069 CCCTGTGGCTGCCCTGGGCCCGG + Intronic
1073442489 10:103560642-103560664 CCCTGTGCATGCCCAGGGTGGGG - Intronic
1073900405 10:108214719-108214741 CCCAGTACCAGCCCAGAGCCTGG - Intergenic
1074232610 10:111552932-111552954 CCCTGTGCCTGCCCACAGGAGGG - Intergenic
1074533325 10:114311613-114311635 CCATGTGCCTGCCCTGTGCTGGG - Intronic
1074803630 10:117026779-117026801 CTCTGGGCCTGCCCAGGGCTGGG + Intronic
1075025422 10:118980206-118980228 CCCTGTTCCTCCCAAGTGCCTGG - Intergenic
1075375425 10:121974812-121974834 CGCTGTCCCCGCCCTGCGCCGGG - Intronic
1075419601 10:122290982-122291004 ACCTCTGCCTGCCCAGCTGCAGG + Intronic
1075567043 10:123512389-123512411 CCCAGTGCCCACCCAGCGCCTGG + Intergenic
1075682314 10:124341646-124341668 CCCTTGGGCTGCCCAGGGCCTGG - Intergenic
1076354017 10:129839459-129839481 CCCTGTGCCTGCCCAGCGCCTGG - Intronic
1076362068 10:129896550-129896572 CCCTGTCCCTGCACAGCGAGTGG + Intronic
1076666235 10:132094557-132094579 CCCAGTACCAGCCCAGAGCCTGG - Intergenic
1076676808 10:132151387-132151409 CCCCTTGCCTGCCCAGCCCCTGG + Intronic
1076686396 10:132200199-132200221 CCCACTTCCTGCCCAGGGCCAGG + Intronic
1076922090 10:133459465-133459487 CCCTGTGCGTCCCCATCCCCAGG + Intergenic
1077112721 11:869035-869057 CCCAGGGCCTCCCCAGAGCCTGG + Exonic
1077147430 11:1052413-1052435 CCCTGAGGCTCCCCAGCTCCTGG + Intergenic
1077217783 11:1402219-1402241 TGCTGTGCCTGCCCCGCCCCGGG - Intronic
1077237557 11:1489013-1489035 CTCTGTTCCTGGCCAGCTCCTGG - Intronic
1077242018 11:1515631-1515653 GGCAGTCCCTGCCCAGCGCCCGG + Intergenic
1077342356 11:2031802-2031824 CGCTCTGCCTGCCCACCTCCAGG + Intergenic
1077362459 11:2146745-2146767 CCCTGTACCTGCCCCACGACAGG - Exonic
1077483286 11:2826567-2826589 CCCTGTGGGTGCCCAGCTGCAGG - Intronic
1077498786 11:2899545-2899567 GCCTGTGCGTCCCCAGCCCCAGG - Exonic
1077684903 11:4282682-4282704 GCCTCAGCCTGCCCAGTGCCTGG + Intergenic
1077690287 11:4335248-4335270 GCCTCAGCCTGCCCAGTGCCTGG - Intergenic
1077910196 11:6566477-6566499 ACCTGTGCCTGCTCTGGGCCAGG - Intronic
1078118351 11:8479552-8479574 CACTGTGCCTGGCCAGCTTCTGG - Intronic
1078518880 11:12047651-12047673 CCCAGCCCCTGCCCAGGGCCAGG + Intergenic
1078547064 11:12254224-12254246 CCCAGAGCCTGCCAAGTGCCAGG + Intronic
1079018191 11:16887506-16887528 GCCTCAGCCTGCCCAGTGCCTGG + Intronic
1079034841 11:17013135-17013157 CCCTCTGCCTGCTGAGCTCCGGG - Intronic
1079355624 11:19728022-19728044 CCCTGTCCCTGCTCAGGACCAGG - Intronic
1079362597 11:19781584-19781606 CCCTGGGCCTGTCCACAGCCAGG + Intronic
1081091062 11:38867024-38867046 CCCAGTACCAGCCCAGAGCCTGG - Intergenic
1081326693 11:41754098-41754120 CCCAGTACCAGCCCAGAGCCTGG - Intergenic
1081538464 11:44012988-44013010 CCCTGGGCTAGCCCAGTGCCGGG + Intergenic
1081887871 11:46514761-46514783 CACTGTGCCTGCCCACTGGCAGG + Intronic
1082166598 11:48956409-48956431 GCCTCAGCCTGCCCAGTGCCTGG - Intergenic
1082836868 11:57657511-57657533 ACCTGTCCCTGCCCAGCGCGGGG + Exonic
1083419165 11:62543863-62543885 CACGGTGCCAGCCCAGCTCCGGG + Intronic
1083528480 11:63395517-63395539 CCCAGTACCAGCCCAGAGCCTGG - Intronic
1083626904 11:64076507-64076529 CCCAGTGCCAGCACAGGGCCCGG - Intronic
1083682705 11:64358777-64358799 CTCTCAGCCTGCCCAGCACCAGG + Intergenic
1083695414 11:64439219-64439241 CCCTCTCGCTGCCCAGCGCTGGG + Intergenic
1083961109 11:66015553-66015575 CCCTGTGCCTGCCCCATGCTGGG - Intergenic
1084943810 11:72628218-72628240 CCATGTGCCAGGCCTGCGCCGGG + Intronic
1085318691 11:75561684-75561706 CCCGGTACCTGCCCGGCACCCGG - Intergenic
1085399701 11:76228418-76228440 CCCCCTGCCTGCCCAGTGCCTGG - Intergenic
1085478902 11:76805763-76805785 CTCTGTGCCAGCCCAGTACCTGG + Intergenic
1088788488 11:113203569-113203591 CCCTGTTCCAGCTCAGTGCCGGG + Intronic
1088798648 11:113286159-113286181 TGCTCTGCCTGCCCAGCCCCTGG + Intergenic
1088927701 11:114319183-114319205 CACTGTGCCTGACCAACGACTGG - Intergenic
1089008027 11:115108784-115108806 CCCTGTGTCTGCTCTGCGTCTGG + Intergenic
1089169638 11:116503061-116503083 ACCTGTCCCTGCCCCGTGCCTGG + Intergenic
1089456411 11:118628298-118628320 CCCATGGGCTGCCCAGCGCCGGG - Exonic
1089562040 11:119348187-119348209 CCCAGTGCCTGGCCAGACCCCGG - Intergenic
1089579553 11:119472912-119472934 CACTGTACCTGCCCTGCCCCAGG - Intergenic
1089714067 11:120339026-120339048 TCTTGTGCCTGCACAGTGCCTGG - Intronic
1089965280 11:122650522-122650544 CACTGCGCCTGGCCAGTGCCAGG + Intergenic
1090753097 11:129764337-129764359 CCCAGTGCCAGCCCAGAGCCTGG + Intergenic
1091132866 11:133161014-133161036 CCCAATGCCTGCCCCGCACCAGG - Intronic
1091200728 11:133778470-133778492 CCCTGTGACTGCACAAGGCCAGG + Intergenic
1091275114 11:134344725-134344747 CCCTGCCCCAGCCCAGCGGCCGG - Intronic
1202825342 11_KI270721v1_random:86991-87013 CGCTCTGCCTGCCCACCTCCAGG + Intergenic
1091595936 12:1879100-1879122 CCCTGGGCCTGTCCAGAGCCTGG + Intronic
1093095180 12:14963792-14963814 CACTGTGCCTGCCCTGCTCTAGG - Intergenic
1093991190 12:25591557-25591579 CCCTGGACATGCCCAGGGCCTGG + Intronic
1094369093 12:29716725-29716747 CCCTGTGCCCGGCCAGCTCTTGG - Intronic
1095289273 12:40458183-40458205 CCCAATGCCTGCCCATTGCCAGG - Intronic
1096241335 12:49961807-49961829 CCCCGCGCCGGCCCCGCGCCCGG + Intergenic
1096347947 12:50866823-50866845 CCCAGTACCAGCCCAGAGCCTGG + Intronic
1096956910 12:55535196-55535218 CCCAGTACCAGCCCAGAGCCAGG + Intergenic
1097042519 12:56164302-56164324 CCCAGTGCCAGCCCACTGCCAGG - Exonic
1097228762 12:57495883-57495905 GCCTCAGCCTGCCCAGTGCCTGG - Intronic
1097760614 12:63459869-63459891 CCCAGTACCAGCCCAGAGCCAGG + Intergenic
1098061656 12:66569596-66569618 CCTGGTGCCTGCCCAGGGCCAGG - Intronic
1098491962 12:71092620-71092642 CCCTGGACCTGCCCAGGGCCTGG - Intronic
1098500663 12:71187888-71187910 ACCAGTGCCAGCCCAGAGCCTGG + Intronic
1098774026 12:74588816-74588838 CCCTCAGCCTGCCGAGTGCCTGG - Intergenic
1099255566 12:80308290-80308312 CCCTCTGCCTGGCAACCGCCCGG - Intronic
1100088073 12:90936241-90936263 CCCAGTACCAGCCCAGAGCCAGG - Intronic
1100669454 12:96795038-96795060 CTCTGTACCAGCCCAGAGCCCGG - Intronic
1100697176 12:97107660-97107682 CCCAGTACCAGCCCAGAGCCCGG - Intergenic
1100951333 12:99853426-99853448 CCCAGTACCAGCCCAGAGCCTGG + Intronic
1100970339 12:100063308-100063330 CCCAGTACCAGCCCAGAGCCTGG + Intronic
1101878425 12:108610305-108610327 CCCTGTCCCTGCCTGGTGCCTGG - Intergenic
1102224905 12:111221456-111221478 CGCAGTGCCAGCCCAGAGCCTGG - Intronic
1102346291 12:112163311-112163333 CCCAGTGCCTCCCCAGCCCTGGG + Intronic
1102656424 12:114485498-114485520 GCCTCAGCCTGCCCAGTGCCTGG - Intergenic
1103536986 12:121639968-121639990 CACTGTGCCTGTCCTGCGGCTGG + Intronic
1103846697 12:123907032-123907054 CCCAGTGCCTGCTCAGGGCAGGG - Intronic
1104747827 12:131221182-131221204 CCCTGCCCCTGCCCTGGGCCAGG - Intergenic
1104802470 12:131563976-131563998 CCATGCACCTGCCCTGCGCCTGG + Intergenic
1105202992 13:18195045-18195067 CCCTTTGCCTGAGGAGCGCCCGG - Intergenic
1106081955 13:26507648-26507670 CACTGTGCCTGGCCATCTCCCGG - Intergenic
1106252619 13:27994214-27994236 ACCCATGCCTGCCCAGCTCCTGG - Intergenic
1106503569 13:30352472-30352494 CACTGTCCCTGCCCAGCCTCGGG + Intergenic
1106747845 13:32722239-32722261 GCCTCAGCCTGCCCAGTGCCTGG - Intronic
1107097258 13:36550084-36550106 CCCTGTGGCTGCACTGAGCCTGG + Intergenic
1107434829 13:40372976-40372998 CCCTGTGTCTCCCCCGGGCCAGG - Intergenic
1108131959 13:47310932-47310954 CCCAGTACCAGCCCAGAGCCTGG + Intergenic
1108433865 13:50382379-50382401 CCCTTTGCCTGCCATGGGCCTGG - Intronic
1108685743 13:52817585-52817607 GCCTCAGCCTGCCCAGTGCCTGG + Intergenic
1109111071 13:58318956-58318978 GCCTGTGCCAGCCCAGAGACGGG + Intergenic
1110506583 13:76294802-76294824 GCCTCAGCCTGCCCAGTGCCTGG + Intergenic
1110561928 13:76918445-76918467 CCCAGTACCAGCCCAGAGCCAGG + Intergenic
1110627629 13:77668904-77668926 CCCAGTACCAGCCCAGAGCCAGG + Intergenic
1112500632 13:99940439-99940461 CCCTGTGGCTGCTCAGCTCTGGG + Intergenic
1112561124 13:100515056-100515078 CCCTGGGTCTGCCCAGCTCATGG + Intronic
1112738148 13:102443827-102443849 CCCAGTACCAGCCCAGAGCCGGG + Intergenic
1113662562 13:112117504-112117526 CCCTGGGCTGGTCCAGCGCCCGG - Intergenic
1113839982 13:113353585-113353607 CCGTGTCCTTGCCCAGCCCCTGG - Intronic
1113962137 13:114132189-114132211 CCCTGCGCCTCCTCTGCGCCCGG - Intronic
1114336549 14:21697402-21697424 GCCTTAGCCTGCCCAGTGCCTGG + Intergenic
1114531974 14:23402147-23402169 GCCTTTGCCTGCCCAGCCCTTGG - Intronic
1114692252 14:24595063-24595085 CCCAGTACCAGCCCAGAGCCAGG - Intergenic
1115641226 14:35336886-35336908 GCCTGAGCCTGCTCAGGGCCTGG + Intergenic
1115835422 14:37397273-37397295 CCCAGTACCAGCCCAGAGCCGGG - Intronic
1115969872 14:38932968-38932990 CCCAGTACCAGCCCAGAGCCTGG + Intergenic
1116079465 14:40154786-40154808 CCCTGGCACTGCCCAGGGCCTGG + Intergenic
1117067162 14:52022433-52022455 TCCTGTGCATGCCCAGGTCCCGG - Intronic
1118140137 14:63071905-63071927 CCCAGTACCTGCCCAGAGCCTGG - Intronic
1118309758 14:64683574-64683596 CCCCCTCCCTGCCCAGCCCCTGG - Intergenic
1119035691 14:71228721-71228743 CCCAGTGCCTTGCCAGAGCCTGG + Intergenic
1119098531 14:71856768-71856790 CCCAGTACCAGCCCAGAGCCGGG + Intergenic
1119438415 14:74612433-74612455 CCATCTGCCCGACCAGCGCCTGG - Intergenic
1119522173 14:75294381-75294403 CCCGGTCCCTGCCCCGCCCCTGG + Intergenic
1120400270 14:84022595-84022617 CCCAGTACCAGCCCAGAGCCTGG - Intergenic
1121459927 14:94066678-94066700 CCCAGTACCAGCCCAGAGCCGGG + Intronic
1121503407 14:94458309-94458331 CCCAGTACCAGCCCAGAGCCTGG - Intergenic
1121540698 14:94723796-94723818 CACTGTGCCTGGCCATCTCCAGG + Intergenic
1121622511 14:95360396-95360418 CCGTGTCGCTGCCCAGCGGCCGG + Intergenic
1121715640 14:96071842-96071864 CCTTGTGCCTGTCCAGCCCTGGG + Intronic
1121740910 14:96251823-96251845 CCCTGTGCCCACACAGGGCCTGG + Intronic
1121813332 14:96910748-96910770 CTCTGTGCCTGAGCAGCACCTGG - Intronic
1122149752 14:99718494-99718516 CCCAGTGCCTGGCCAGGGCCTGG + Intronic
1122151242 14:99727242-99727264 CCCTGTGCCCACCCAGGGCCCGG + Exonic
1122268170 14:100556419-100556441 CCCAGCGCGTGCCCAGGGCCAGG + Intronic
1122271550 14:100570579-100570601 CCCTGGACCAGCCCAGCACCTGG + Intronic
1122293487 14:100692328-100692350 CTCAGTCCCTGCCCGGCGCCGGG + Intergenic
1122593010 14:102869034-102869056 CCCTCTGCCAGCCCAGCCCTTGG + Intronic
1122687959 14:103518886-103518908 CACTGTCCCTGCCCAGCCTCTGG - Intergenic
1122739280 14:103861914-103861936 CCCTTAGCCTGCCCGGAGCCAGG + Intergenic
1122782516 14:104149659-104149681 CCCTCTGCCTGGCCAGCCCGTGG + Intronic
1122814886 14:104307472-104307494 CAGGGTGCCTGCCCAGTGCCAGG + Intergenic
1122904552 14:104795769-104795791 CCCCGCGCCCGCCCCGCGCCCGG + Intergenic
1122969797 14:105147921-105147943 CCCAGGGCCAGCCCAGGGCCAGG - Intronic
1123053737 14:105559804-105559826 CCCTGCCCCTGCCCCGAGCCCGG + Intergenic
1123067399 14:105625566-105625588 GCCTGTGGCTGCCCGGAGCCTGG + Intergenic
1123071415 14:105644290-105644312 GCCTGTGCCTGCCTGGAGCCTGG + Intergenic
1123078320 14:105680221-105680243 CCCTGCCCCTGCCCCGAGCCCGG + Intergenic
1123091076 14:105742572-105742594 GCCTGTGCCTGCCCAGAGCCTGG + Intergenic
1123096844 14:105770906-105770928 GCCTGTGCCTGCCCGGAGCCTGG + Intergenic
1123108361 14:105853382-105853404 CCCGGTGCCAGCACAGCGCAGGG + Intergenic
1124226623 15:27900760-27900782 ACCTGTGAATGCCCAGCTCCCGG - Intronic
1124594938 15:31084366-31084388 CCCTGACCCTGCCCAGCTCCTGG + Intronic
1124667972 15:31609913-31609935 CCCAGTACCAGCCCAGAGCCGGG + Intronic
1124712904 15:32030303-32030325 CCCGGAGCGTACCCAGCGCCGGG + Intergenic
1125608007 15:40953160-40953182 CCCGGTGCCCGCCCTGGGCCCGG + Exonic
1126577564 15:50211323-50211345 CCCAGTACCAGCCCAGAGCCAGG + Intronic
1126683715 15:51228526-51228548 CCCTGAGCTTGGCCAGCGCCTGG + Intronic
1126752068 15:51886549-51886571 GCCTCAGCCTGCCCAGTGCCTGG - Intronic
1127194530 15:56569235-56569257 CCCAGTACCAGCCCAGAGCCTGG + Intergenic
1128776369 15:70323466-70323488 ACCTCGGCCTGCCCAGCTCCTGG + Intergenic
1128843863 15:70872278-70872300 GCCTCAGCCTGCCCAGTGCCTGG - Intronic
1129031563 15:72622065-72622087 CACTGTGCCTGGCCATTGCCTGG + Intergenic
1129218369 15:74115404-74115426 CACTGTGCCTGGCCATTGCCTGG - Intronic
1129383528 15:75183027-75183049 CCCAGGGCCTGCCCTGTGCCTGG - Intergenic
1129405975 15:75318175-75318197 CACTGTGCCTGGCCATTGCCTGG + Intergenic
1129456286 15:75677579-75677601 CCCTGTGACTTCCCAGGTCCTGG + Intronic
1129600377 15:76995097-76995119 CCCTGTGCCTGCCCCGGGGGAGG + Exonic
1129774888 15:78230123-78230145 CCTTGAGCCTGCCCAGGGCCTGG - Intronic
1130196588 15:81785088-81785110 CCCTGTGCCTGCCTACAGGCAGG + Intergenic
1130539356 15:84811127-84811149 GCCTGTGCCTGCACATCTCCAGG - Intergenic
1131166451 15:90145409-90145431 CCCTGGGTCTGCCCTCCGCCTGG - Intergenic
1131268485 15:90932601-90932623 CCCCGGGCCTCCCCGGCGCCAGG - Intronic
1131326778 15:91455817-91455839 CCCAGTACCAGCCCAGAGCCTGG - Intergenic
1132044670 15:98553532-98553554 CCCTCTGTATGCCCAGCACCAGG - Intergenic
1132647139 16:1004321-1004343 TCCTGTGCCTGCCGTGCTCCGGG - Intergenic
1132749676 16:1451807-1451829 CCCTGTGCCTGGCCAGCATCAGG + Intronic
1133325120 16:4937341-4937363 CCCAGTGCCTGCCCGGCCTCCGG - Intronic
1134023496 16:10937901-10937923 CACTCTGCCTTCCCAGCCCCAGG - Intronic
1134090895 16:11391171-11391193 CCAAGGCCCTGCCCAGCGCCAGG - Intronic
1134402290 16:13920813-13920835 CACTGTGCCTGCACAGTGTCAGG - Intronic
1135024115 16:18986105-18986127 CACTGTGCCTGGCCAGCCACCGG - Intronic
1135042686 16:19130072-19130094 CCCTGTGCCAGCACAGGGCCTGG - Intronic
1135045471 16:19151458-19151480 CACTGTGCCTGGCCAGTGCTTGG + Intronic
1135517578 16:23148784-23148806 CCCGGTACTGGCCCAGCGCCAGG + Exonic
1135883168 16:26279223-26279245 CCCAGTACCAGCCCAGAGCCAGG - Intergenic
1136773544 16:32859861-32859883 CCCTGGCCCTGCCCAGGTCCTGG + Intergenic
1136799589 16:33059273-33059295 CTTTGTGCCCCCCCAGCGCCAGG + Intergenic
1136897068 16:34001658-34001680 CCCTGGCCCTGCCCAGGTCCTGG - Intergenic
1137350183 16:47706713-47706735 CCCTGTGCCAGAACAGCGTCAGG - Intergenic
1137430942 16:48417386-48417408 GCCTCAGCCTGCCCAGTGCCTGG - Intronic
1138142254 16:54578785-54578807 CCCTGTGACAGCACAGGGCCTGG + Intergenic
1138797904 16:59992818-59992840 CCCAGTACCAGCCCAGAGCCAGG - Intergenic
1140619875 16:76716914-76716936 CCCAGTACCTTCCCAGAGCCAGG + Intergenic
1140905192 16:79403492-79403514 CTCTGTGCATGCCCACTGCCAGG + Intergenic
1140908557 16:79430560-79430582 CTCTGTGCCTGCCGTGTGCCGGG - Intergenic
1140945505 16:79764717-79764739 CCCTGTGCCTCCACACAGCCTGG + Intergenic
1141669592 16:85484905-85484927 CCCTGTGCCTGCCCTGGGCATGG + Intergenic
1141685891 16:85569836-85569858 CCTTGCACCTGCCCACCGCCTGG + Intergenic
1141686291 16:85571790-85571812 CCCTGGGCCTGGCCACCGACAGG - Intergenic
1141998296 16:87648652-87648674 CCCTCTCCCAGCCCAGGGCCGGG - Intronic
1142177436 16:88651526-88651548 GCCTGTGCCAGCCCAGAGCCAGG - Intergenic
1142226838 16:88881665-88881687 GCCTGGGACTGCCGAGCGCCTGG + Intronic
1142289153 16:89184824-89184846 TCCTGGGCCTGCCCAGTGCAGGG - Intronic
1203075960 16_KI270728v1_random:1121972-1121994 CCCTGGCCCTGCCCAGGTCCTGG + Intergenic
1142495075 17:301904-301926 CCTTTTGCCTGCCCATCTCCTGG + Intronic
1142732997 17:1875007-1875029 CCCTGTTCTTTCCCAGCGCAGGG + Intronic
1142811599 17:2398026-2398048 CCCTGTGCCTGCAGAGCACCTGG - Intronic
1143324020 17:6086791-6086813 CTCTGTTCCTGCCAAGAGCCTGG - Intronic
1143783378 17:9240741-9240763 CCCTGCCCCTGCCCAGCGTGGGG + Exonic
1145034828 17:19533782-19533804 CCCAGAGCCCGCCCCGCGCCTGG - Intronic
1145158269 17:20557067-20557089 GCCTCAGCCTGCCCAGTGCCTGG + Intergenic
1145269015 17:21394605-21394627 CTCTGTGCCTGCCCTGTGCTGGG + Intronic
1146065378 17:29630950-29630972 CAGTGTGCATGCCCAGCTCCAGG - Exonic
1146446660 17:32937548-32937570 CCCAGTGCCCACCCAGAGCCTGG - Intronic
1146513855 17:33473720-33473742 CCCTGTTCCTGCCAAGCTCCAGG + Intronic
1146942834 17:36855563-36855585 CTCTGTGCCTGCATAGCACCTGG - Intergenic
1147142284 17:38466482-38466504 CCCCGTGCCTTCCCAGAGCCTGG + Exonic
1147463129 17:40588737-40588759 CCCAGTACCAGCCCAGAGCCAGG - Intergenic
1148146208 17:45366688-45366710 CCCTCTGCCTGCTGAGCCCCAGG + Intergenic
1148222585 17:45874072-45874094 CCCTGGGCCTGAGCAGCTCCAGG - Intergenic
1149430713 17:56594095-56594117 CCCTGCGCCTGCCCAGCCTCGGG + Exonic
1149595307 17:57861736-57861758 CTCTGAGCCTTCCCCGCGCCAGG - Exonic
1150266796 17:63837442-63837464 TCCCATGCCTGCCCAGCGCCGGG - Exonic
1150518159 17:65836915-65836937 GCCTCAGCCTGCCCAGTGCCTGG + Intronic
1150894770 17:69196896-69196918 CCGAGTGCCTGCCGAGTGCCTGG - Intronic
1151272383 17:73006994-73007016 GCCTCTGCATCCCCAGCGCCTGG - Intronic
1151324088 17:73368312-73368334 CCCCATGCCTGCCAAGAGCCCGG + Intronic
1151373566 17:73666621-73666643 CCCTGCCCCTGCCCTGGGCCTGG - Intergenic
1151444384 17:74153663-74153685 CCCTGTGCCTCCTCAGCTCCTGG - Intergenic
1151453560 17:74213505-74213527 CCCCGTGCCCGCCCCGCCCCCGG - Exonic
1151784869 17:76270518-76270540 CCCAGCTCCAGCCCAGCGCCCGG - Exonic
1151951528 17:77356813-77356835 TCCTGAGGCTGCTCAGCGCCTGG - Intronic
1151958476 17:77392620-77392642 CCCTCTGCCTTCCCAAGGCCAGG - Intronic
1151970372 17:77454573-77454595 GCCTGTGCCTGCCCAGCTGCTGG + Intronic
1151999284 17:77635274-77635296 CCTTATGTCTGCCCAGCTCCTGG - Intergenic
1152421421 17:80195353-80195375 CCCAGTGCCACCCCAGTGCCAGG - Intronic
1152594226 17:81230447-81230469 CCCCGTCCCTGCCCGGCGCCTGG - Intronic
1152635920 17:81430456-81430478 CACTGGGCCTGGCCAGCTCCTGG + Intronic
1152733879 17:81987284-81987306 CCCAGTGCCCACACAGCGCCTGG - Intronic
1153457564 18:5296399-5296421 CCCGGCGCCGGCGCAGCGCCGGG + Intronic
1153646957 18:7204117-7204139 GCCTCAGCCTGCCCAGTGCCTGG - Intergenic
1154156897 18:11950953-11950975 CACTGTGCCTGGCCAGGGCTTGG + Intergenic
1154415045 18:14171902-14171924 CCTTGTCCCTGCCCAGACCCTGG - Intergenic
1156030436 18:32706854-32706876 CCCTGTGCCTGTCAAGCTCCAGG - Intronic
1157249326 18:46080839-46080861 CACTGTGCCTGGCCCACGCCAGG - Exonic
1157500605 18:48187866-48187888 TCCTCTCCCTGCCCAGCCCCTGG - Intronic
1157540928 18:48505886-48505908 CCCAGTACCAGCCCAGAGCCGGG + Intergenic
1157703223 18:49778839-49778861 CCCGGTACCAGCCCAGAGCCTGG - Intergenic
1157717708 18:49900373-49900395 CCCTGTGCCCACCCTGTGCCTGG + Intronic
1158097712 18:53793174-53793196 CCCAGTACCAGCCCAGAGCCTGG + Intergenic
1160025465 18:75211902-75211924 CCCGTTACCTGCCGAGCGCCGGG - Intronic
1160035538 18:75298326-75298348 CCCTTTCCTTGCCCAGCTCCTGG + Intergenic
1160515652 18:79478075-79478097 CCCCCTGCCTGCCCATCCCCAGG + Intronic
1160576350 18:79856431-79856453 CCCTGTACCTTCACAGAGCCAGG + Intergenic
1160590310 18:79940931-79940953 ACCTGTGCCTGCCCTCCCCCGGG - Intronic
1160686358 19:438717-438739 CTCCGTGCCTGCCACGCGCCAGG - Exonic
1160805223 19:989632-989654 CCCCCTGCCTGCCCTGCCCCAGG - Intronic
1160877316 19:1302739-1302761 CCCCGCCCCTGCCCAGCGCGGGG + Intergenic
1160887959 19:1360783-1360805 CCCTCGGCCTGCTCAGAGCCTGG + Exonic
1160966881 19:1750572-1750594 CTCTGTGCCTGGCCTGCGTCTGG - Intergenic
1161040252 19:2106886-2106908 CCCGTTGCCTCCCCAGCCCCTGG - Intronic
1161104605 19:2437064-2437086 CCCTGGGCCTGGCCAGAGCGGGG + Intronic
1161585747 19:5104569-5104591 CCCTGTGCCTGCTCTTTGCCGGG - Intronic
1162378907 19:10320826-10320848 CCCGGCGCCTCCCCAGCCCCGGG + Exonic
1162495488 19:11021110-11021132 TCCTGTGCCTGCCAACGGCCTGG - Intronic
1162500534 19:11050927-11050949 GCCAGTGCCTGCACAGCACCAGG - Intronic
1162557691 19:11397565-11397587 GCCTGGACCTGCCCAGCCCCCGG - Exonic
1162646524 19:12054011-12054033 CACTGCGCCCGGCCAGCGCCCGG - Intergenic
1162887132 19:13703992-13704014 CCCTCTGCCCGGCCACCGCCCGG + Intergenic
1162937968 19:13991166-13991188 CCCTTCTCCTGCCCAGCTCCTGG - Intronic
1163112694 19:15170894-15170916 CACTTTCCCTCCCCAGCGCCTGG + Intronic
1163254053 19:16144160-16144182 CTCTGTGCCAGGCCAGCACCAGG + Intronic
1163441180 19:17323523-17323545 CCGTGTGCTGGCCCAGCGGCTGG - Exonic
1163476076 19:17526930-17526952 CACTGTGCCTACCCTGTGCCCGG - Intronic
1163486630 19:17591440-17591462 CCCTGAGTCTGCCCAGCCACAGG + Intergenic
1163683701 19:18698596-18698618 CACTGCGCCTGCTGAGCGCCCGG - Intronic
1163758601 19:19121049-19121071 ACCTGTGCCTGGCCAAGGCCCGG - Exonic
1164016929 19:21261659-21261681 GCCTCGGCCTGCCCAGTGCCTGG - Intronic
1164517256 19:28947117-28947139 GCCTGTGCCTGACCATTGCCAGG + Intergenic
1164678093 19:30115802-30115824 CCCTGTGCCTGCCCAGGGCCTGG + Intergenic
1164753602 19:30673498-30673520 CCCTGTGCCTGCCACGGGACTGG + Intronic
1165121249 19:33560216-33560238 CCCTGAGGCTGCCCCGGGCCTGG - Intergenic
1165488776 19:36111256-36111278 CCATCTGCCTGACCAGCTCCGGG + Exonic
1165942278 19:39420905-39420927 CCCTGTGTGAGCCCAGCTCCCGG - Intronic
1166747895 19:45150651-45150673 ACCTCTGCTTGCCCAGCCCCAGG + Exonic
1166831409 19:45641905-45641927 CCTTGTGCCTTACCTGCGCCCGG + Exonic
1167053868 19:47096528-47096550 CCCAGTGTCTGCACAGCTCCTGG - Intronic
1167449192 19:49557026-49557048 CCCTGGGCCCGCCCAGCCCGCGG + Intronic
1167642318 19:50688594-50688616 CGCTGTGCCTGGCCATCCCCCGG + Intronic
1168251454 19:55144634-55144656 CCCTCTGCCTGCGCAGCGGCAGG - Intronic
1202657425 1_KI270708v1_random:36750-36772 CCCCATGCCTGCCCAGCCTCAGG - Intergenic
1202680790 1_KI270712v1_random:4863-4885 CTTTGTGCCCCCCCAGCGCCAGG - Intergenic
925263535 2:2548121-2548143 CTCTGTCCCTGCCCACTGCCAGG + Intergenic
925300418 2:2807754-2807776 CCTTCTGACTGCCCACCGCCAGG + Intergenic
926190318 2:10722809-10722831 CCCAGTGACTGCCCAGAACCAGG - Exonic
926478419 2:13357311-13357333 CCCTGGACCTGCCCAGGGCCTGG + Intergenic
926724440 2:15986561-15986583 CCCTGTGCCTGCACTGAGCCTGG + Intergenic
926977229 2:18526858-18526880 GCCTGTGCCCTCCCAGCGCAGGG - Intergenic
927176705 2:20415003-20415025 CCCAGTGCCAGCCCAGAGCCCGG - Intergenic
927363433 2:22264420-22264442 CCCAGTACCAGCCCAGAGCCTGG - Intergenic
927481425 2:23457098-23457120 CCCTGTGCCTTCCCGACGCCGGG + Intronic
927685250 2:25166153-25166175 CACCGTGCAGGCCCAGCGCCTGG - Intronic
927757866 2:25723446-25723468 CCCTCTGCCTGGCAACCGCCCGG - Intergenic
927970804 2:27305518-27305540 CCCTGTGCTTTCCCAGCCACCGG + Intronic
928009633 2:27595012-27595034 GCCTGGGCCTGCCCAATGCCTGG - Intronic
929032622 2:37663215-37663237 CCATGTGCCTCCCCAGCCCCTGG + Intronic
929806081 2:45145882-45145904 CCCAGTACCAGCCCAGAGCCTGG + Intergenic
930025311 2:47025835-47025857 CCCCGTGCCTGTCCAGGACCTGG - Intronic
930363485 2:50411139-50411161 GCCTCAGCCTGCCCAGTGCCTGG + Intronic
931757639 2:65388395-65388417 CGCCCTGCCTGCCCAGTGCCTGG + Intronic
932158227 2:69437489-69437511 CCCAGTGCCCGCCCAGCTACCGG - Exonic
932270438 2:70404135-70404157 CCCAGTACCAGCCCAGAGCCTGG + Intergenic
932494854 2:72141206-72141228 CCCTTCCCCTGCCCAGGGCCTGG - Intronic
933110813 2:78397635-78397657 CCCAGTACCAGCCCAGAGCCCGG + Intergenic
934709176 2:96503862-96503884 CCCTGTGCCAGCCCAGCCACTGG - Intronic
934980250 2:98833570-98833592 CTCTGTGCCTGCCTAGATCCTGG + Intronic
935165105 2:100563203-100563225 CACTGCGCCTGCGCAGGGCCTGG - Intronic
935212233 2:100947879-100947901 CCCTGTGCACGCCCAGTGCGAGG - Intronic
935255775 2:101308496-101308518 CCCTGTGCGTGCCCGGGGCCCGG - Exonic
936344416 2:111664359-111664381 GCCTGTGCCTCCCCAGGCCCTGG - Intergenic
937252765 2:120534741-120534763 CTCTGAGCCAGCCCAGCCCCAGG - Intergenic
938237646 2:129719451-129719473 CCCTCTGCCTTCCCAGCCCCTGG - Intergenic
938254716 2:129847537-129847559 GTCTGTGCCTGCCCAGGGCTGGG - Intergenic
938299311 2:130198860-130198882 CCCTGTTCCCACCCAGCACCCGG + Intergenic
938451590 2:131425482-131425504 CCCTGTCCGCGCCCACCGCCCGG + Intergenic
938457404 2:131475677-131475699 CCCTGTTCCCACCCAGCACCTGG - Intronic
938996454 2:136683655-136683677 CCCAGTACCAGCCCAGGGCCTGG + Intergenic
940217596 2:151316197-151316219 CCCAGTACCAGCCCAGAGCCTGG + Intergenic
943100194 2:183478662-183478684 GCCTCAGCCTGCCCAGTGCCTGG + Intergenic
943449298 2:188028299-188028321 CCCAGTACCAGCCCAGAGCCTGG - Intergenic
944751921 2:202717901-202717923 CTCTGGACCTGCCCAGGGCCTGG - Intronic
944838984 2:203607561-203607583 CCCTCTCCCTGCCCAGCCCCAGG - Intergenic
946192329 2:218014060-218014082 CTCTGTGCCTGCCCTGAGCCAGG - Intergenic
946219850 2:218217163-218217185 CCCGGTCCCCGCCCAGCCCCCGG - Intronic
946253803 2:218429398-218429420 CCCTGCGCTTGCCCAGCACGTGG - Exonic
946420273 2:219560878-219560900 CCGGGTGGCTGCCCAGCCCCGGG + Intronic
947235976 2:227941257-227941279 CCCAGTACCAGCCCAGAGCCTGG - Intergenic
948072426 2:235138576-235138598 CACTGTGACTGACCAGCGCCCGG + Intergenic
948600234 2:239103772-239103794 CTCTATGCCAGCCCAGCACCTGG + Intronic
948668955 2:239554203-239554225 GCATTTGCCTGCCCAGCGCTGGG + Intergenic
948689432 2:239692504-239692526 CCAAGTGGCTGCCCAGTGCCAGG + Intergenic
948980714 2:241493243-241493265 CCCTGTGGCAACCCAGCCCCTGG + Exonic
949065355 2:241987025-241987047 CCCTGTGCCAGGCGAGTGCCTGG - Intergenic
1168761548 20:353361-353383 CGCTGTGCCTGCCAGGCGACAGG - Exonic
1169066176 20:2695278-2695300 CTCTGTGCCTACCCAGAGGCAGG + Intronic
1169068473 20:2707598-2707620 TCCTGTGCCCACCCAGCACCAGG - Intronic
1169336125 20:4759123-4759145 CCCAGTGCCAGCCCAGAGCTGGG - Intergenic
1170536296 20:17344287-17344309 GACTGTGCCTCCCCAGCACCAGG - Intronic
1170756086 20:19208421-19208443 CCCTGTGCCAGCCCCTCACCAGG - Intergenic
1170828677 20:19820603-19820625 CCCTGAGCCAGCCCAGCCTCAGG + Intergenic
1171953377 20:31440956-31440978 TCCTCTTCCTGCCCAGCTCCAGG + Intronic
1172020418 20:31909919-31909941 GCCTGTGAGTGCCCAGTGCCAGG + Exonic
1172123371 20:32611306-32611328 CCCTCTGCCTGCCCACAGCTTGG - Intergenic
1174304101 20:49602997-49603019 CCCTGTGCCAGCCCACCTCTGGG + Intergenic
1174380703 20:50153718-50153740 CCCAATGACCGCCCAGCGCCGGG + Exonic
1174401583 20:50278738-50278760 CCCAGTGCCATCCCAGTGCCTGG + Intergenic
1174558330 20:51412444-51412466 CCCTGCTCCTGCCCACCCCCTGG - Intronic
1174838149 20:53877211-53877233 CCCTGTGGCTGCCCAGACCAGGG - Intergenic
1174963687 20:55186239-55186261 CCCTCTGCCTGCCCTGGGCCAGG - Intergenic
1175202549 20:57288057-57288079 CCCAGTGCCTGCCCACTGTCAGG - Intergenic
1175413175 20:58784831-58784853 CTCGGTGCCTGCCCTGTGCCCGG - Intergenic
1175790571 20:61737736-61737758 CCCAGTGCCTGCCCTATGCCAGG + Intronic
1175794831 20:61765126-61765148 CCCTGTCCCTGCTCAGCACTGGG + Intronic
1175855713 20:62119872-62119894 CCGAGTGCCTGCCCAGCCCGTGG - Intergenic
1175952774 20:62592280-62592302 CCCCATGCCTGCCCAGGGCCAGG + Intergenic
1175963437 20:62648386-62648408 CCCTGTGGCTGCCCCGCCCCAGG - Intronic
1175988556 20:62776455-62776477 CCCCGTGGCTGCCCAGGGACAGG - Intergenic
1176092000 20:63322304-63322326 CCATGTGCCTGCAGGGCGCCTGG + Intronic
1176714967 21:10342960-10342982 CCCTTTGCCTGAGGAGCGCCCGG + Intergenic
1177140586 21:17353459-17353481 CCCAGTACCAGCCCAGAGCCTGG + Intergenic
1177788440 21:25696271-25696293 GCCTCAGCCTGCCGAGCGCCTGG - Intronic
1177995291 21:28089601-28089623 CCCAGTACCAGCCCAGAGCCAGG - Intergenic
1178914148 21:36697736-36697758 CCCTGGCCCTCCCCTGCGCCAGG - Intergenic
1179591536 21:42412379-42412401 ACCTGAGCCTGCACAGCCCCTGG - Intronic
1179629090 21:42665749-42665771 CCCTGCCCCTGCCCAGAGACTGG + Intronic
1179985357 21:44917935-44917957 CTCTGTGCTTGCTCAGGGCCTGG + Intronic
1179998756 21:44985739-44985761 TCCTGTCCCTGCCCATGGCCTGG - Intergenic
1180148669 21:45936368-45936390 CTCTGTGCCTGACCAGCAACCGG - Intronic
1180603383 22:17036978-17037000 CCCTTTGCCTGAGGAGCGCCCGG - Intergenic
1180733899 22:18001509-18001531 CCATGTGCCCGCCCATCCCCCGG - Intronic
1181102342 22:20549848-20549870 CCCACTGCCAGCCCAGCACCTGG - Intronic
1181371103 22:22417474-22417496 CCCAGTACCAGCCCAGAGCCGGG + Intergenic
1181493519 22:23275263-23275285 CTCTGAGTCTGCCCAGCTCCAGG - Intronic
1181579827 22:23821989-23822011 CACTGTGCCTGGCCAGAGCTGGG + Intronic
1181717001 22:24738296-24738318 TTCTGTACCTGCCCAGGGCCTGG + Intronic
1181735274 22:24876619-24876641 CCCTGTGGCAGCCCAGTCCCCGG + Exonic
1182430238 22:30294912-30294934 CCCCCTGCCTGCCCGGGGCCTGG + Intronic
1182664117 22:31944860-31944882 CCCCGTCCCTCCCCAACGCCAGG - Intronic
1183281550 22:36935235-36935257 CCCTGGGCCTGCACAGAGCGGGG + Intronic
1183395444 22:37568586-37568608 CCCAGTGCCTGCCGAGGGCAGGG - Exonic
1183497038 22:38152493-38152515 CACTGTGCCTGGCCCGTGCCTGG + Intronic
1183504236 22:38200265-38200287 ACCACTGCCTGCCCAGTGCCTGG - Intronic
1183581479 22:38729093-38729115 CCCAGAGCCTGCACAGAGCCTGG - Intronic
1183596217 22:38813733-38813755 TCCTGTCCCTGCCCACCTCCTGG - Intergenic
1184101844 22:42344886-42344908 CCCTGTGCCTGCCACGGCCCAGG - Intergenic
1184201213 22:42971198-42971220 GCCTCAGCCTGCCAAGCGCCTGG + Intronic
1184425922 22:44409286-44409308 CCCTGAGGCTGCCCAGGGCCAGG - Intergenic
1184582979 22:45429617-45429639 CCCCCTGCCTGCCCAGGTCCCGG - Intronic
1184727566 22:46355737-46355759 TCCTGTGCCTGCCCTGAGCGAGG + Intronic
1184740968 22:46428898-46428920 AGCTGAGCCTGCCCAGAGCCTGG - Intronic
1184745187 22:46452000-46452022 CCCCCTGCCTCCCCGGCGCCTGG - Intronic
1185071672 22:48659992-48660014 CCCTGTTCCTCCCCTGCTCCGGG + Intronic
1185109733 22:48894255-48894277 CCCTCTGCCTGGGCAGCGTCCGG + Intergenic
1185183052 22:49373999-49374021 GCCTCTGCCTGCCCAGTGCTTGG - Intergenic
949235622 3:1805683-1805705 CTCTGGACCTGCCCAGGGCCTGG - Intergenic
949950100 3:9221943-9221965 CTCTGTGCCTGCTCAGCGCCTGG + Intronic
950465519 3:13151042-13151064 CCCTGTGCCTGTCCTGCTGCTGG - Intergenic
950614103 3:14145855-14145877 CCCTGGGCATGCCCAGCCCCTGG - Exonic
950644808 3:14370866-14370888 CCTTCTGCCTGCCCTGCCCCAGG + Intergenic
951269684 3:20608696-20608718 CCCAGTACCAGCCCAGAGCCAGG + Intergenic
953125521 3:40088486-40088508 CCCAGTGCCTGCTCTGTGCCAGG + Intronic
953881514 3:46693648-46693670 CGCTGTGGTTGCCCCGCGCCGGG + Exonic
954363578 3:50134820-50134842 CCCTCTGCTTGCCCAGCTGCTGG - Intergenic
954367753 3:50155330-50155352 CCCTGAGCCTTCCCATGGCCCGG + Exonic
954390848 3:50267339-50267361 CCCTTTGCCTGCTGAGCCCCTGG + Intergenic
954558237 3:51535096-51535118 CACCGTGCCTGGCCAGTGCCTGG + Intergenic
954712813 3:52513351-52513373 CCCTCGCCCTGCCCAGAGCCGGG + Intronic
954804091 3:53205522-53205544 CACTGTGCCTGGCCAGTGCCTGG - Intergenic
955860037 3:63319056-63319078 CCCAGTACCAGCCCAGAGCCAGG - Intronic
955941261 3:64149082-64149104 CCCTGTGACAGGCCTGCGCCAGG + Intronic
956414608 3:69013339-69013361 CCCGGCCCCTTCCCAGCGCCCGG - Intronic
956476192 3:69622279-69622301 TCCTGGACCTGCCCAGGGCCTGG + Intergenic
956886941 3:73569734-73569756 CCCTAGTCCAGCCCAGCGCCTGG - Intronic
958030357 3:88101280-88101302 CCCAGTGCCTACCCAGCTCAAGG + Intronic
959009672 3:101060857-101060879 CCCAGTACCAGCCCAGAGCCAGG - Intergenic
959053974 3:101551001-101551023 GCCTCGGCCTGCCCAGTGCCTGG + Intergenic
959715671 3:109430753-109430775 CCCAGTACCAGCCCAGAGCCTGG - Intergenic
961514003 3:127421672-127421694 CCCTGTGAGTGCCCAGGGCAGGG + Intergenic
961550416 3:127667758-127667780 CTCTGTTCCAGCCCAGCTCCAGG + Intronic
962249551 3:133827358-133827380 CCCTGAGCCTGCACAGAGCCAGG - Exonic
962263590 3:133929902-133929924 CCCTCTGCCTGCTCAGGGCCTGG - Intergenic
962283336 3:134067935-134067957 CCCTGTGCCTTCCTCGCCCCGGG - Intronic
962739331 3:138351377-138351399 TTCTATGCCTGCCCAGGGCCTGG - Intronic
962740842 3:138361701-138361723 CCCTTGGCCTCCCCAGAGCCTGG - Intronic
962759049 3:138492285-138492307 CTCTGTACTTGCCCAGGGCCTGG - Intergenic
963776526 3:149445627-149445649 GCCTCAGCCTGCCCAGTGCCTGG - Intergenic
963933898 3:151033476-151033498 CAGTGTGCCTGCCCTGTGCCAGG + Intergenic
964075729 3:152689118-152689140 CCCAGTACCAGCCCAGAGCCTGG + Intergenic
964571295 3:158110018-158110040 CCCTCGGCATTCCCAGCGCCTGG + Intronic
965510646 3:169565202-169565224 CCCTGTGCCTAGCAAGCACCAGG + Intronic
966927197 3:184652476-184652498 CCCTGTGCCTACCCTGGCCCTGG + Intronic
967527624 3:190513564-190513586 CCCTGTGCCGGCACAGAGCGCGG - Intergenic
967921454 3:194617263-194617285 CCCTCTCTCTGCCCAGTGCCGGG - Exonic
968085764 3:195873257-195873279 CCCTGCCCCTGCCCAGGCCCCGG - Intronic
968189130 3:196654765-196654787 CTCTGTGCCTGCCTAGCACAGGG + Intronic
968515291 4:1013068-1013090 CCCTGGGCCTGCCCAGCTCTAGG + Intronic
968517993 4:1022880-1022902 ACCTGTCCAAGCCCAGCGCCCGG - Intronic
968618991 4:1595214-1595236 CCCTGTGGCCGTCCAGAGCCTGG - Intergenic
968879447 4:3291831-3291853 CCCTGTGGCTTCCCGGCTCCCGG + Intergenic
968935472 4:3607923-3607945 CCCTGGGCCTGCCCCCAGCCTGG - Intergenic
969165578 4:5307926-5307948 CCCAGTACCAGCCCAGAGCCTGG - Intronic
969288272 4:6221985-6222007 CACTGTCCCCGCCCAGCCCCGGG + Intergenic
969306234 4:6327718-6327740 AGCTGTGCCAGCCCAGCCCCGGG + Intronic
969429822 4:7147636-7147658 CCTTGTGCCTGCCCAGGCCTGGG + Intergenic
969481263 4:7448310-7448332 CTCTGTGCCTGGCCGGCGCAGGG - Intronic
969493990 4:7515476-7515498 CCCTGGGCCCTCCCAGCGCCTGG + Intronic
971050341 4:22855093-22855115 CCCAGTACCAGCCCAGAGCCTGG - Intergenic
972700926 4:41492284-41492306 GCCTCGGCCTGCCCAGTGCCTGG - Intronic
972899707 4:43668536-43668558 CCCAGTACCAGCCCAGAGCCTGG - Intergenic
973317658 4:48779400-48779422 CGCTGTGCCCGCGCAGCCCCGGG - Intronic
973831495 4:54764456-54764478 CCCAGTACCAGCCCAGAGCCTGG - Intergenic
975615364 4:76241166-76241188 CACTGTGCGTGCCCAGGGACAGG - Intronic
975942890 4:79668771-79668793 CCCAGTACCAGCCCAGAGCCTGG + Intergenic
976444180 4:85111015-85111037 CTCTGGACCTGCCCAGGGCCTGG + Intergenic
978157078 4:105501092-105501114 GCCTCAGCCTGCCCAGTGCCTGG - Intergenic
978170509 4:105664718-105664740 CCCTATGCCTGCCCAGGGCAAGG - Intronic
979434689 4:120674223-120674245 CCCAGCACCTGCCCAGAGCCTGG + Intergenic
979704896 4:123709567-123709589 CCCAGTACCAGCCCAGAGCCAGG + Intergenic
980087148 4:128403403-128403425 CCCAGTGCCAGCCCAAAGCCGGG - Intergenic
980087713 4:128409137-128409159 CCCAGTACATGCCCAGAGCCTGG - Intergenic
980523586 4:133961254-133961276 CCCAGTACCAGCCCAGAGCCTGG + Intergenic
983251494 4:165351355-165351377 CCCAGTACCAGCCCAGAGCCCGG - Intergenic
983533139 4:168832071-168832093 CCCGATACCTGCCCCGCGCCCGG + Intronic
984987584 4:185346302-185346324 CCTTGTGACTTCCCAGCTCCCGG + Intronic
985155431 4:186982881-186982903 CTCTTTGCCTGCCCAGCACCTGG + Intergenic
985520789 5:373243-373265 CCCTGGCCCTGCCCTGCACCCGG + Intronic
985563538 5:603835-603857 GGCTGTGCCTGCCCAGCGGAGGG - Intergenic
985618956 5:943296-943318 CCCTGCACCTTCCCAGAGCCAGG + Intergenic
985639369 5:1056463-1056485 GCCTGTGCCTGCCCCGTGCACGG - Intronic
985705739 5:1400503-1400525 CCCTGTGGCTTCCCATGGCCAGG + Intronic
985725580 5:1514232-1514254 CCCTGTGCCTGGCCTGTGCCGGG - Intronic
985784370 5:1886382-1886404 GCCTGTGCCCGCCCACCGCTCGG + Intronic
985823171 5:2174766-2174788 CCCTGAGGCTGCCCTGCTCCTGG + Intergenic
986347291 5:6846733-6846755 CCCTGGGCACGCCCTGCGCCGGG - Intergenic
986740420 5:10700672-10700694 CCCAGTGCCTGCCCAGTGCTGGG + Intronic
987006035 5:13710155-13710177 CCCAGTACCAGCCCAGAGCCAGG + Intronic
987084428 5:14455924-14455946 GCCTGAGCCTCCGCAGCGCCCGG - Intronic
988929774 5:36026418-36026440 CCCTGTTTCTACCCAGCCCCTGG + Intergenic
989574609 5:42978809-42978831 GCCTCAGCCTGCCCAGTGCCTGG + Intergenic
990501238 5:56398537-56398559 GCCTCAGCCTGCCCAGTGCCTGG - Intergenic
990983497 5:61621667-61621689 CTCTGTGCCTTCCCACCTCCTGG + Intergenic
991562064 5:67964314-67964336 GCCTGTTCCAGCCCAGCCCCAGG - Intergenic
992340015 5:75814157-75814179 CCCAGTACCAGCCCAGAGCCTGG - Intergenic
994028638 5:95114706-95114728 CTCTGGACCTGCCCAGGGCCTGG + Intronic
994517073 5:100785282-100785304 GCCTCTGCCTGCCGAGTGCCTGG + Intergenic
995456713 5:112360386-112360408 GCCTCAGCCTGCCCAGTGCCTGG + Intronic
996031872 5:118714464-118714486 CCCAGTACCAGCCCAGAGCCTGG + Intergenic
996058921 5:119011362-119011384 CCCTGAGCCAGCCCTGCGTCGGG + Intergenic
996128583 5:119753725-119753747 CCCAGTACCAGCCCAGAGCCTGG + Intergenic
997105914 5:131019378-131019400 CCCAGTACCAGCCCAGAGCCTGG - Intergenic
997433697 5:133858719-133858741 GCCTGGGCCTGCCGAGTGCCTGG - Intergenic
997470491 5:134114657-134114679 CCCAGTGCCCGCCCCGCCCCCGG + Intergenic
997478279 5:134162378-134162400 CACTGTGCCTGGCCAGCGAAAGG + Intronic
998141633 5:139702988-139703010 CACTGTGCCTGGCCTGTGCCTGG - Intergenic
998291123 5:140915891-140915913 CTCTGGGCCTGCCCAGGGCCAGG - Intronic
998381544 5:141729530-141729552 CCCTCTTCCTGACCAGAGCCAGG - Intergenic
999086165 5:148892243-148892265 CCCAGTGCCAGCCCAGAGCCTGG + Intergenic
999269695 5:150289626-150289648 TCACCTGCCTGCCCAGCGCCAGG - Exonic
999310207 5:150546941-150546963 CCCATTCCCTGCACAGCGCCAGG - Intronic
999325026 5:150638615-150638637 CCCTGTGCCAGCCTAGGGCCAGG - Intronic
1001177728 5:169487303-169487325 CCCTGGACATGCCCAGGGCCTGG + Intergenic
1001540769 5:172536768-172536790 CACTGTGCCTGGCCTGTGCCTGG + Intergenic
1001560519 5:172666010-172666032 GCCTGTGCCAGTCCAGTGCCTGG + Intronic
1001604419 5:172949775-172949797 CACTGTGCCTGGCCAGGGCAAGG - Intronic
1001889142 5:175324529-175324551 ACCACTGCCTGCCCAGCCCCAGG + Intergenic
1002000620 5:176194641-176194663 CCCCATGCCTGCCCAGGGCTTGG + Intergenic
1002168194 5:177360986-177361008 CCCTGTGTTTGCCCACAGCCAGG - Intronic
1002253719 5:177944340-177944362 CCCCATGCCTGCCCAGGGCTTGG - Intergenic
1002278785 5:178119181-178119203 CCCTGTGCGGGCCCAGTGCTGGG + Intronic
1002279460 5:178122106-178122128 CCTTGCGCCTCCCCAGCCCCGGG - Exonic
1002306860 5:178288606-178288628 CCCTATGCCTGGCCAGCGTGGGG - Intronic
1002417127 5:179126463-179126485 CCCAGTGCTTGCCCGGCTCCTGG - Intronic
1002435864 5:179230335-179230357 CCCTGTGAGTGCCCAGGGCCAGG - Intronic
1002465354 5:179405651-179405673 CCCTGTCCCTGCCCTGCCACAGG - Intergenic
1002640403 5:180628026-180628048 GCCTCTGCTTGCCCAGCTCCAGG + Intronic
1002719063 5:181246939-181246961 CCCTGTCCTCGCCCAGCTCCCGG + Intronic
1003212410 6:4079327-4079349 CCCTGTCCCTGCGCCCCGCCCGG + Exonic
1003567130 6:7231004-7231026 CCCTCTCCCTGCCCAGCACCCGG + Exonic
1005072559 6:21875013-21875035 CCCAGTACCAGCCCAGAGCCAGG + Intergenic
1005995059 6:30925864-30925886 CCCTGTTCTTCCCCAGGGCCTGG + Exonic
1006679639 6:35787761-35787783 CCATGTGCTTGCCCACAGCCAGG - Intronic
1006811508 6:36823249-36823271 TCCAGGGCCTGCCCAGTGCCTGG - Intronic
1007231867 6:40353828-40353850 TCCAGTGCCTGCCCAGAGCTGGG + Intergenic
1007236385 6:40393682-40393704 CCCTGTGCCAGCCCACCCCGAGG + Intronic
1007419803 6:41712701-41712723 CCCCGTGCCTGCCCAGGGCCTGG - Intronic
1007715150 6:43851403-43851425 CCCTCTCTCTGCCCAGTGCCCGG - Intergenic
1008106450 6:47444519-47444541 GCCTCAGCCTGCCCAGTGCCTGG - Intergenic
1008296701 6:49786847-49786869 GCCTGTGCCAACCCAGCTCCTGG - Exonic
1008305386 6:49892779-49892801 CCCAGTACCAGCCCAGAGCCTGG + Intergenic
1008775337 6:55031625-55031647 CCCAGTACCAGCCCAGAGCCTGG - Intergenic
1008781322 6:55109089-55109111 CCCAGTACCAGCCCAGAGCCTGG + Intronic
1010440911 6:75892676-75892698 CCCAGTACCTCCGCAGCGCCAGG - Exonic
1010679393 6:78781634-78781656 CCCAGTACCAGCCCAGAGCCAGG + Intergenic
1010794838 6:80106772-80106794 CCCCGCGCCAGCCCCGCGCCAGG - Exonic
1011133074 6:84072373-84072395 CCCAGTACCAGCCCAGAGCCAGG - Intronic
1011233392 6:85188317-85188339 CCCAGTGCCAGCCCAGAGCTGGG + Intergenic
1011329011 6:86183489-86183511 CCCAGTACCAGCCCAGAGCCAGG - Intergenic
1011620347 6:89237029-89237051 CCCAGTACCAGCCCAGAGCCTGG - Intergenic
1011965801 6:93156375-93156397 CCCAGTACCAGCCCAGAGCCTGG - Intergenic
1014603964 6:123448912-123448934 CCCAGTACCAGCCCAGAGCCGGG + Intronic
1015663243 6:135600038-135600060 CCCAGTACCAGCCCAGAGCCTGG - Intergenic
1015921336 6:138269170-138269192 GTCTGTGGCTGCCCACCGCCTGG - Intronic
1015939016 6:138430824-138430846 GCCTCTGCCTCCCCAGCGCTTGG + Exonic
1016877569 6:148879134-148879156 CCCTGTGCCAGCCCACTCCCAGG + Intronic
1016910065 6:149190087-149190109 CCCAGTACCAGCCCAGAGCCTGG - Intergenic
1018168688 6:161126592-161126614 CCCTGGACCAGCCCAGAGCCCGG - Intergenic
1018247727 6:161838797-161838819 CCCTGAGCTCGCCCTGCGCCAGG + Intronic
1018787885 6:167122162-167122184 CACTGTGCCTCCCCACCCCCAGG - Intergenic
1018834217 6:167471082-167471104 CCCTGTGCCCGCCAAGTGCAGGG + Intergenic
1018848438 6:167571210-167571232 CTGTGTGCCCGGCCAGCGCCAGG + Intergenic
1018928347 6:168222589-168222611 CTCTGTGGCTGCCCAGTGGCAGG - Intergenic
1019576074 7:1738214-1738236 TCTTGTGGCTGCCCAGGGCCGGG + Intronic
1019604092 7:1899836-1899858 CCCTGTCCCTGCTCACCTCCAGG - Intronic
1019628205 7:2032155-2032177 CCCAGTCCCTGTCCAGTGCCTGG + Intronic
1019633295 7:2061651-2061673 ACCTGGGCATGCCCAGCGCAAGG + Intronic
1019706320 7:2498844-2498866 CCTGGTTCCTGCCCAGAGCCCGG + Intergenic
1019726536 7:2605977-2605999 ACCTGTGCCTGGCCCGGGCCAGG - Exonic
1020037729 7:4974681-4974703 CTCGCTCCCTGCCCAGCGCCCGG - Intergenic
1020073793 7:5244242-5244264 CCCTGTGCCTGGCTAGAGACTGG - Intergenic
1021061626 7:16119264-16119286 CTGTGTGCCTGCCCAGGGCTGGG - Intronic
1021907833 7:25353131-25353153 CCCTGTGACTTCCCAGAGGCTGG - Intergenic
1022172126 7:27840717-27840739 CCTTTTGCCTGCCCAGTTCCTGG - Exonic
1022187725 7:27986768-27986790 GCCTCAGCCTGCCCAGTGCCTGG + Intronic
1022648275 7:32251637-32251659 CCCTGCACCTGCACAGTGCCTGG + Intronic
1022729489 7:33009024-33009046 CACTGTGCCTGGCCAGCCTCTGG + Intergenic
1023011055 7:35925100-35925122 CACTGTGCCTGGCCAGAGCTGGG - Intergenic
1023400915 7:39792685-39792707 CTCAGTGCCTGCCCATCTCCTGG + Intergenic
1023862198 7:44223491-44223513 CCCTGTGCCTTCCTAGAGCTGGG - Intronic
1023869075 7:44253006-44253028 CCCTCTCCCTGCCCAGCTCTAGG + Intronic
1024053393 7:45644347-45644369 CTCTGACCCTGCCCAGCCCCAGG - Intronic
1024080072 7:45848743-45848765 CACTGTGCCTGGCCAGAGCTGGG + Intergenic
1024174820 7:46828105-46828127 CCCTGTACCAGCCCACAGCCTGG + Intergenic
1024304996 7:47922025-47922047 GCCTCAGCCTGCCCAGTGCCTGG + Intronic
1024480049 7:49853328-49853350 CCCTGTCCCTCCCCAGGCCCAGG + Intronic
1024648717 7:51388092-51388114 CTCAGTGCCTGCCCATCTCCTGG - Intergenic
1024669227 7:51577121-51577143 CCCAGTACCAGCCCAGAGCCAGG - Intergenic
1025014677 7:55429837-55429859 CCCTGTGCCTCGCCAGTGCCTGG + Intronic
1025176095 7:56803219-56803241 CCCAGCTCCTGCCCAGCTCCTGG - Intergenic
1025178241 7:56812561-56812583 CTCAGTGCCTGCCCAGCTCCTGG - Intergenic
1025178673 7:56814303-56814325 CTCAGTGCCTGCCCAGCTCCTGG - Intergenic
1025179111 7:56816093-56816115 CTCAGTGCCTGCCCAGCTCCTGG - Intergenic
1025179566 7:56817979-56818001 CTCAGTGCCTGCCCAGCTCCTGG - Intergenic
1025180016 7:56819817-56819839 CTCAGTGCCTGCCCAGCTCCTGG - Intergenic
1025180487 7:56821799-56821821 CTCAGTGCCTACCCAGCTCCTGG - Intergenic
1025180934 7:56823648-56823670 GACTCTGCCTGCCCAGCTCCTGG - Intronic
1025181361 7:56825388-56825410 CTCAGTGCCTGCCCAGCTCCTGG - Intronic
1025181808 7:56827226-56827248 CTCAGTGCCTGCCCAGCTCCTGG - Intergenic
1025690111 7:63749769-63749791 CTCAGTGCCTGCCCAGCTCGTGG + Intergenic
1025690558 7:63751592-63751614 CTCAGTGCCTGCCCAGCTCGTGG + Intergenic
1025691006 7:63753415-63753437 CTCAGTGCCTGCCCAGCTCCTGG + Intergenic
1025691442 7:63755191-63755213 CTCAGTGCCTGCCCAGCTCGTGG + Intergenic
1025691882 7:63757014-63757036 CTCAGTGCCTGCCCAGCTCGTGG + Intergenic
1025692330 7:63758837-63758859 CTCAGTGCCTGCCCAGCTCGTGG + Intergenic
1025692774 7:63760660-63760682 CTCAGTGCCTGCCCAGCTCGTGG + Intergenic
1025693191 7:63762339-63762361 CTCAGTGCCTGCCCAGCTCGTGG + Intergenic
1025693635 7:63764162-63764184 CTCAGTGCCTGCCCAGCTCGTGG + Intergenic
1025695699 7:63773203-63773225 CCCAGCTCCTGCCCAGCTCCTGG + Intergenic
1025976941 7:66377294-66377316 CCCAGCTCCTGCCCAGCTCCTGG - Intronic
1025977239 7:66378762-66378784 CCCAGCTCCTGCCCAGCACCTGG - Intronic
1026045551 7:66903619-66903641 CCCAGCTCCTGCCCAGCTCCTGG + Intergenic
1026466658 7:70660356-70660378 CTCTGTGCAAGCCCAGGGCCCGG + Intronic
1026837985 7:73650745-73650767 ACCTGTTCATGGCCAGCGCCAGG + Intergenic
1026949853 7:74339797-74339819 CACTGTGCCTGGCCAGGACCAGG - Intronic
1027202229 7:76071570-76071592 CCCAGCTCCTGCCCAGCTCCTGG - Intergenic
1027328970 7:77071285-77071307 CCCCGTACCAGCCCAGAGCCTGG - Intergenic
1028605110 7:92646684-92646706 CACTGCGCCTGGCCAGCACCTGG + Intronic
1029439163 7:100577782-100577804 CCCTGGTCCAGCCCAGCTCCCGG + Intronic
1030065491 7:105655873-105655895 CCCTGTGCATGCCCTGCAGCAGG - Intronic
1030706475 7:112697911-112697933 GCCTCAGCCTGCCCAGTGCCTGG - Intergenic
1030890184 7:114990496-114990518 CCCTCTGCCTGCCCCACGACAGG + Intronic
1031050029 7:116935601-116935623 CCCTGTGCCTGGCCAGAGCCTGG + Intergenic
1031675860 7:124610946-124610968 CCCAGTACCAGCCCAGAGCCTGG + Intergenic
1032081201 7:128859341-128859363 GCCTCTGCCTCCCCAGGGCCCGG - Intergenic
1032658055 7:133953307-133953329 CACTGCGCCTGGCCACCGCCTGG - Intronic
1034475132 7:151277162-151277184 CCCTGCGCCTCCCCCGCTCCGGG - Intronic
1034676253 7:152894622-152894644 CCCTTTGCCTGCAGAGCGCTGGG + Intergenic
1034683129 7:152946622-152946644 CCCAGTACCGGCCCAGAGCCTGG - Intergenic
1034943182 7:155245135-155245157 CCCTCTGCAGGCCCAGCTCCTGG + Intergenic
1035266602 7:157693031-157693053 CTCTGTCTCTGCCCAGGGCCGGG - Intronic
1035577609 8:717846-717868 TCTTGTGCCTGCCCAGCCTCAGG - Intronic
1036210986 8:6841311-6841333 CCCGGTGTCTGCCTAGCCCCAGG - Intergenic
1036559424 8:9888961-9888983 TCCTGTGCCTCCCCACCACCTGG - Intergenic
1037134728 8:15446610-15446632 GCCTCAGCCTGCCGAGCGCCTGG - Intronic
1037295708 8:17397617-17397639 CTCTGGACCTGCCCAGGGCCTGG + Intronic
1037885752 8:22595354-22595376 CCCCGTTTCTGACCAGCGCCTGG - Intronic
1038183276 8:25248747-25248769 GCCTGTGCCTCCCTAGCTCCTGG + Intronic
1038367138 8:26948044-26948066 CCCAGTGCAAGCCCAGAGCCAGG - Intergenic
1041637179 8:60156884-60156906 CCCAGTACCAGCCCAGAGCCGGG + Intergenic
1041897207 8:62938592-62938614 CCCAGTACCAGCCCAGAGCCCGG + Intronic
1042431467 8:68711009-68711031 CCCAGTACCAGCCCAGAGCCCGG + Intronic
1042796012 8:72664184-72664206 CCCTGTGTCAGCTCAGCTCCTGG + Intronic
1042836048 8:73079859-73079881 CCCAGCGCCAGCCCAGCACCTGG + Intronic
1043121618 8:76332311-76332333 CCCAGTACCAGCCCAGAGCCTGG - Intergenic
1043545188 8:81307073-81307095 CCCGGTACCAGCCCAGAGCCTGG + Intergenic
1044523812 8:93229642-93229664 CCGAGAGCCTGCCCACCGCCGGG + Intergenic
1044582372 8:93835106-93835128 GCCTCAGCCTGCCCAGTGCCTGG - Intergenic
1044865998 8:96571879-96571901 CCCAGTGACTTCACAGCGCCAGG - Intronic
1044969294 8:97604467-97604489 GCCTCAGCCTGCCCAGTGCCTGG + Intergenic
1045034772 8:98168516-98168538 CTCTGCGCCTGCCGAGCTCCTGG + Intergenic
1045994689 8:108349151-108349173 CACTGTACCTGTCCAGAGCCAGG + Intronic
1046735936 8:117777222-117777244 GCCTCAGCCTGCCCAGTGCCTGG + Intergenic
1047032424 8:120896763-120896785 CCCAGTACCAGCCCAGAGCCAGG + Intergenic
1047937435 8:129796689-129796711 CCCAGTACCAGCCCAGAGCCTGG - Intergenic
1048804390 8:138226515-138226537 CCCTGTGGTTGCACAGAGCCTGG + Intronic
1049351167 8:142165537-142165559 ACCTGTGCCAGCCCAGCCCAGGG + Intergenic
1049621000 8:143598299-143598321 CCCCGTGCTGGCGCAGCGCCAGG - Exonic
1049709488 8:144057221-144057243 CCGTGTCCATGCCCAGGGCCCGG + Exonic
1049733530 8:144191516-144191538 CCCTGGGCCTGGCCAGCATCTGG + Intronic
1049783577 8:144439972-144439994 CCCTGGGCCTGCTCTGGGCCGGG - Intronic
1049796096 8:144497891-144497913 CTCTGTGCCTGCCCAGGGCCTGG - Intronic
1049847197 8:144808546-144808568 CCCTTTCCCTCCCCAGTGCCCGG - Exonic
1050643745 9:7696201-7696223 CCCTCTGCCTTCCCAGCCTCTGG + Intergenic
1051080205 9:13285298-13285320 CCCAGTGCCAGCACAGTGCCTGG + Intergenic
1051725888 9:20088177-20088199 GCCTGTGGCTGCTCAGCCCCTGG - Intergenic
1052258947 9:26492070-26492092 GCCTCGGCCTGCCCAGTGCCTGG + Intergenic
1052849905 9:33371714-33371736 CCCTGTGCCAGCCTTGTGCCAGG + Intergenic
1052894659 9:33735630-33735652 CCCAGTGCCAGCCCAGAGCCTGG + Intergenic
1053414630 9:37939313-37939335 GGCTGAGCCTGCCCAGCTCCTGG - Intronic
1054454709 9:65423933-65423955 CCCTGGGCCTGCCCCCAGCCTGG + Intergenic
1055611827 9:78031752-78031774 CCCTGTCCGCGCCCACCGCCCGG + Intergenic
1055617931 9:78092703-78092725 CCCTGGGCCTGCCCAACTCACGG - Intergenic
1056066094 9:82936744-82936766 CACTGCGCCCGGCCAGCGCCCGG - Intergenic
1056097666 9:83272216-83272238 GCCTCAGCCTGCCCAGTGCCTGG + Intronic
1056505510 9:87254414-87254436 CCCTGAGCCTCCCCGGCCCCAGG + Intergenic
1056940266 9:90949566-90949588 CCATGGGCTTGCCCAGGGCCTGG + Intergenic
1056968740 9:91185480-91185502 CCCTGTGCCTGACGAGTGGCTGG + Intergenic
1057076036 9:92138581-92138603 CCCTGTACCTTCCCAGCACAGGG - Intergenic
1057119431 9:92558439-92558461 CCCAGTACCAGCCCAGAGCCGGG - Intronic
1057353414 9:94318086-94318108 CCCTGTGGGTTCCCAGTGCCTGG + Intergenic
1057654337 9:96939506-96939528 CCCTGTGGGTTCCCAGTGCCTGG - Intronic
1058005120 9:99906552-99906574 ACCTGTGCGCCCCCAGCGCCCGG + Intergenic
1058084970 9:100739364-100739386 CCCAGTACCAGCCCAGAGCCAGG - Intergenic
1058244338 9:102604153-102604175 GCCTCGGCCTGCCGAGCGCCTGG - Intergenic
1058368441 9:104235939-104235961 GCCTGGGCCTGCCGAGTGCCTGG - Intergenic
1058375332 9:104316174-104316196 GCCTCAGCCTGCCCAGTGCCTGG + Intergenic
1058820968 9:108728891-108728913 CTCTGGACCTGCCCAGGGCCAGG + Intergenic
1060223149 9:121774864-121774886 GCTTGTGCCTGCCCACGGCCTGG + Intronic
1060251067 9:121987171-121987193 CCATGTCCCTGCCCAGCCCTGGG - Intronic
1060667926 9:125443993-125444015 CCGTGTGCCTGGCCACGGCCTGG - Intronic
1060792490 9:126496026-126496048 CACTGTGCCTGCACAGCCCTGGG - Intronic
1060945429 9:127567457-127567479 CCCTGTGCCCAGCCAGCCCCAGG + Intronic
1061118303 9:128628257-128628279 CCCCGTGCCTGTCCAGCCACCGG + Intronic
1061165494 9:128919800-128919822 CCTTGAGGCTGTCCAGCGCCTGG + Intergenic
1061188306 9:129067997-129068019 CCCGGTTCCTGCCCTGCCCCAGG + Intronic
1061296235 9:129678377-129678399 CCCTGTGCCTGGCCAGGGCCTGG - Intronic
1061512573 9:131069983-131070005 CCCTGTGCCCACCCAGCTTCAGG + Intronic
1061625142 9:131837079-131837101 GCCTATGCCTGCCCAGCTCACGG - Intergenic
1061811282 9:133163869-133163891 CCCGCTGCCTGCCCTGCTCCAGG - Exonic
1061878283 9:133555823-133555845 CCCTGTCGCTGCTCAGCTCCAGG - Exonic
1061899814 9:133667021-133667043 CCCAGAGCCAGCCCAGCACCTGG + Intronic
1061977163 9:134075272-134075294 GCCTCAGCCTGCCCAGTGCCTGG + Intergenic
1062012156 9:134273051-134273073 CCCTGAGCCTGCTCAGCCCCGGG + Intergenic
1062047101 9:134429405-134429427 CCCTGTGCCAGCCCTGCCTCTGG + Intronic
1062233230 9:135494905-135494927 TCCTCCTCCTGCCCAGCGCCTGG + Intergenic
1062423720 9:136496623-136496645 ACCAGGGCCTGCCCAGCACCCGG - Exonic
1062491100 9:136805261-136805283 CTCTGTACCTGCCCAGCTGCTGG - Intronic
1062534019 9:137013701-137013723 CCCGGTGCGTGCCCAGCCTCAGG + Intronic
1062537129 9:137025967-137025989 CCCAGTGCCTTCACATCGCCTGG + Intronic
1062581720 9:137231839-137231861 GCCTGTCTCTGCCCAGTGCCTGG - Intronic
1062601246 9:137319537-137319559 GCCTGAGCCTGCCCAGCCCTAGG + Intronic
1185523161 X:756890-756912 CCCAGAGCCTGCCCAGGACCAGG + Intergenic
1187219137 X:17307426-17307448 CCCAGTACCAGCCCAGAGCCAGG - Intergenic
1187706591 X:22015336-22015358 CCGTGTGCCTGCCCAACCCTGGG - Intergenic
1187748450 X:22434035-22434057 CCCAGTACCAGCCCAGAGCCAGG + Intergenic
1188045830 X:25425741-25425763 CCCAGTACCAGCCCAGAGCCAGG - Intergenic
1189491300 X:41473497-41473519 TCCTCGGCCTGCCCAGCGCCTGG + Exonic
1190235212 X:48609957-48609979 CACTGTGCCTGCCCAGCCAGTGG - Intergenic
1190598402 X:52067653-52067675 CCCTGTGCTGGCCCAGACCCTGG - Exonic
1190610422 X:52186420-52186442 CCCTGTGCTGGCCCAGACCCTGG + Exonic
1191151750 X:57227447-57227469 CCCAGTACCAGCCCAGAGCCAGG - Intergenic
1191794591 X:65007458-65007480 GACTGTGCCTGCCCAGGGCAAGG - Intronic
1191902570 X:66055035-66055057 CTCTGTGCCTGCCCACCCCTGGG + Intergenic
1191903505 X:66063995-66064017 CCCAGTACCAGCCCAGAGCCAGG - Intergenic
1192060266 X:67817209-67817231 CCCTGGACCTGCCCAGGGCCTGG + Intergenic
1192640782 X:72859882-72859904 CTCTGGACCTGCCCAGAGCCTGG + Intergenic
1192640929 X:72860894-72860916 CTCTGGACCTGCCCAGAGCCTGG - Intergenic
1193156927 X:78183694-78183716 CCCAGTACCAGCCCAGAGCCAGG + Intergenic
1193631924 X:83899833-83899855 CCCAGTACCGGCCCAGAGCCTGG + Intergenic
1193775882 X:85641532-85641554 CCCAGTACCAGCCCAGAGCCCGG - Intergenic
1194547576 X:95257016-95257038 CCCAGTGCCAGCCCAGAACCTGG - Intergenic
1194558673 X:95394078-95394100 CTCTGGGCCTCCCCAGAGCCAGG + Intergenic
1194701422 X:97119351-97119373 CCCAGTACCAGCCCAGAGCCAGG - Intronic
1195243814 X:102978802-102978824 CCCTGTGGCTGCTCAGTCCCTGG + Intergenic
1196564562 X:117189540-117189562 CTCTGGACCTGCCCAGGGCCTGG + Intergenic
1196910288 X:120477976-120477998 CTCTGGGACTGCCCAGCTCCCGG + Intergenic
1197083593 X:122446865-122446887 CCCAGTACCAGCCCAGAGCCAGG + Intergenic
1197120149 X:122881076-122881098 CCCAGTACCAGCCCAGAGCCCGG + Intergenic
1197132474 X:123020512-123020534 CCCAGTACCAGCCCAGAGCCAGG + Intergenic
1197953760 X:131924222-131924244 CCCAGTACCAGCCCAGAGCCAGG + Intergenic
1199121651 X:144061311-144061333 CCCAGTACCAGCCCAGAGCCTGG + Intergenic
1199206008 X:145148960-145148982 CCCAGTACCAGCCCAGAGCCTGG + Intergenic
1199277700 X:145965119-145965141 CTCTGGACCTGCCCAGGGCCTGG + Intergenic
1199810914 X:151347480-151347502 CCCAGTGTCTGCCCAGGGACAGG + Intergenic
1200132942 X:153861372-153861394 CCCTGCCCCTTCCCAGAGCCCGG - Intergenic
1200217532 X:154374678-154374700 CCCCGCGCCCGCCCCGCGCCCGG + Intergenic
1200318043 X:155155113-155155135 CCCAGTACCAGCCCAGAGCCTGG - Intergenic
1200795263 Y:7335249-7335271 CCCTGCACCTCCCCAGCCCCTGG - Intergenic
1201294920 Y:12454342-12454364 GCCTCGGCCTGCCCAGTGCCTGG - Intergenic
1201306760 Y:12557008-12557030 CCCAGTACCAGCCCAGAGCCAGG + Intergenic