ID: 1076354020

View in Genome Browser
Species Human (GRCh38)
Location 10:129839484-129839506
Sequence CAGATGAGGCCACACGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 184}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076354020_1076354029 -2 Left 1076354020 10:129839484-129839506 CCCACCCCGTGTGGCCTCATCTG 0: 1
1: 0
2: 1
3: 16
4: 184
Right 1076354029 10:129839505-129839527 TGTGGACAGCTGTGCCCTCGGGG No data
1076354020_1076354027 -4 Left 1076354020 10:129839484-129839506 CCCACCCCGTGTGGCCTCATCTG 0: 1
1: 0
2: 1
3: 16
4: 184
Right 1076354027 10:129839503-129839525 TCTGTGGACAGCTGTGCCCTCGG No data
1076354020_1076354030 2 Left 1076354020 10:129839484-129839506 CCCACCCCGTGTGGCCTCATCTG 0: 1
1: 0
2: 1
3: 16
4: 184
Right 1076354030 10:129839509-129839531 GACAGCTGTGCCCTCGGGGCCGG No data
1076354020_1076354028 -3 Left 1076354020 10:129839484-129839506 CCCACCCCGTGTGGCCTCATCTG 0: 1
1: 0
2: 1
3: 16
4: 184
Right 1076354028 10:129839504-129839526 CTGTGGACAGCTGTGCCCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076354020 Original CRISPR CAGATGAGGCCACACGGGGT GGG (reversed) Intronic
900308893 1:2024084-2024106 AAGATGAGGCCATACTGGATTGG - Intronic
900312347 1:2039981-2040003 CCACTGTGGCCACACGGGGTGGG + Intergenic
900693297 1:3994796-3994818 CAGAGGAGGCCACACAAGGGTGG + Intergenic
901862674 1:12084906-12084928 CAGATGAGGCTACTGGGGCTTGG + Intronic
905210941 1:36373894-36373916 CAGAGCAGGCCTCAGGGGGTGGG - Intronic
908330619 1:63067519-63067541 CAGATGGGGGCTCAAGGGGTAGG - Intergenic
909296336 1:73953966-73953988 AAGATGAGGCCACACTTAGTAGG - Intergenic
915405985 1:155660073-155660095 CAGAGGAGGCCACAAGGGGCTGG + Exonic
915419148 1:155765866-155765888 CAGAGGAGGCCACAAGGGACTGG + Exonic
916735448 1:167603166-167603188 CAGAAGTGGCCAGTCGGGGTGGG + Intergenic
918065658 1:181099698-181099720 CAGATGAGGTCAGACTTGGTGGG - Intergenic
922073027 1:222215228-222215250 TAGATGAGGCCACGCTGGGCAGG - Intergenic
922880886 1:228979551-228979573 CTGATGAGGCCAGTCGGGGCTGG + Intergenic
923539185 1:234876053-234876075 CAGAGGAGGCGACACGGGAGGGG + Intergenic
923986231 1:239386346-239386368 CAGGTGAGGCCATGCTGGGTGGG + Intergenic
924509216 1:244714846-244714868 CAGATGAGGCCAGGCGCGGTGGG + Intergenic
924739316 1:246785703-246785725 GAGGTGAGGCCGCACGGGGACGG - Intergenic
1062838204 10:650199-650221 CTGGGGAGGCCACACGGGGAGGG + Intronic
1063291372 10:4753426-4753448 CAGCTCAGGCCACCTGGGGTGGG + Intergenic
1064739689 10:18420078-18420100 CAGATAAGGCCAAACTGGCTGGG - Intronic
1065936859 10:30528112-30528134 CAGGTTAGGCCACCTGGGGTCGG + Intergenic
1072633653 10:97164003-97164025 CAGATGGGGCCAGGCAGGGTGGG - Intronic
1073176916 10:101562294-101562316 CAGCTGAGGCCACAAGGAGCTGG + Intergenic
1073331726 10:102674381-102674403 CAAAAGCAGCCACACGGGGTAGG + Exonic
1073530984 10:104232008-104232030 CAGGGGAGGTCACACGGGGAGGG + Intronic
1074406137 10:113181671-113181693 CAGATGAGGCCACAGTGCTTAGG + Intergenic
1075427036 10:122350039-122350061 CAGGTGAGGCCCAAAGGGGTGGG + Intergenic
1075709690 10:124523986-124524008 CACCTGAGGTCACACGGAGTGGG + Intronic
1076354020 10:129839484-129839506 CAGATGAGGCCACACGGGGTGGG - Intronic
1076423506 10:130351162-130351184 CAGATCAGGCCACACAGGGTGGG + Intergenic
1076570912 10:131432369-131432391 CAGATGAGGCCAACCAGGGTGGG + Intergenic
1076818232 10:132925126-132925148 CCGCTGAGTCCACACGGGGGAGG - Intronic
1076905818 10:133360414-133360436 CACAGGAGGACAGACGGGGTGGG + Intergenic
1077104929 11:838026-838048 CAGGTGAGGGCACATGGGGGTGG + Exonic
1077412982 11:2412059-2412081 CAGATGAAGCCACTCAGGTTGGG - Intronic
1077540157 11:3142898-3142920 CAGCGGACGGCACACGGGGTGGG + Intronic
1078577817 11:12516555-12516577 CAGAAGAGGCCAGATGGGTTGGG - Intronic
1078725170 11:13923715-13923737 CTAATGAGGCCACTCGGGTTGGG - Intergenic
1078924224 11:15859497-15859519 CAGATGAGGGCACTGGAGGTGGG - Intergenic
1080657444 11:34268897-34268919 AAGATGAGGCCCCACTGGGTAGG - Intronic
1081583338 11:44367177-44367199 CTGAAGAGGCCACAGGGGATGGG - Intergenic
1081802752 11:45870949-45870971 CACAGGAGGCCACAGGAGGTTGG - Intronic
1083771681 11:64871094-64871116 CAGGCGGGGCCAGACGGGGTGGG + Intronic
1083775887 11:64894203-64894225 CACTTGAGGCCACTCGGGGAAGG - Intergenic
1089787150 11:120915854-120915876 CAGATGAGGGCACAGAGGCTTGG + Intronic
1091407773 12:220018-220040 CAGATGTGGCCACGAGGGGGTGG - Intergenic
1091551981 12:1542681-1542703 CAGCTGTGGCAACACAGGGTGGG - Intronic
1099935259 12:89117730-89117752 AAGATAAGGCCACAAGGAGTGGG - Intergenic
1102025034 12:109709637-109709659 CAGGTGAGGCAACTGGGGGTGGG + Intergenic
1102585516 12:113920164-113920186 CAGTTGAGGCCACACCTGCTTGG - Intronic
1102603000 12:114046994-114047016 CACATGTGGCCACACTGGGTTGG + Intergenic
1103906768 12:124331823-124331845 CAGATGAGGCTTCTTGGGGTCGG + Intronic
1104085322 12:125469585-125469607 CACATGAGGTCACACGAGGCAGG + Intronic
1104505571 12:129328880-129328902 TGGATGAGGCCACACAGAGTTGG - Intronic
1104932679 12:132348074-132348096 AAGATGAGGCCACACTGGAGTGG - Intergenic
1105781179 13:23706257-23706279 CACAGGAGGCCACGTGGGGTGGG + Intergenic
1106139772 13:27002436-27002458 GAGATGAGGCCAGAGGAGGTAGG - Intergenic
1113692865 13:112324078-112324100 AAGATGAGGTCACACTGAGTAGG + Intergenic
1114596549 14:23917225-23917247 CAGATGAGGCCAGACAGGAGAGG + Intergenic
1118262434 14:64260088-64260110 CAGATGTGGACACACAGGATAGG + Intronic
1119223842 14:72929120-72929142 CAGAGGAGGCCGGGCGGGGTGGG - Intronic
1122977504 14:105176943-105176965 CAGGTGAGGCCAGCTGGGGTGGG - Exonic
1124860231 15:33432382-33432404 CAGATGAGGCTACAGGGTGAGGG - Intronic
1129518411 15:76170845-76170867 CAGGAGGGGCCACCCGGGGTGGG + Intronic
1132574355 16:657742-657764 CCGCTGTGGCCACACGGGGCAGG - Exonic
1132744209 16:1430006-1430028 AAGCTGAGGGCACACTGGGTGGG + Intergenic
1133027723 16:2995908-2995930 CAGGTGAGGACACCTGGGGTAGG + Intergenic
1140888136 16:79262195-79262217 CAGATGAGGCCTCAGAGGTTTGG + Intergenic
1143106531 17:4533127-4533149 CAGGTGGGGCCCCGCGGGGTGGG + Exonic
1143784651 17:9247398-9247420 CAGCGCAGGCCACACAGGGTGGG - Intergenic
1145007914 17:19347908-19347930 CACATGAGGACACACAGGGGAGG + Intronic
1145756006 17:27390491-27390513 CAGATGAAGCCACACAGTGAGGG - Intergenic
1147441211 17:40448320-40448342 GAGAAGAGGCCACACGGCTTTGG - Intronic
1148444023 17:47726977-47726999 GAGAGGAGGCCCCAGGGGGTGGG + Intergenic
1149512341 17:57254433-57254455 CAGCAGAGGCCACACGGCATTGG + Intergenic
1149595542 17:57862601-57862623 CTGATGAGGCCAGACGGGGCAGG + Exonic
1149636991 17:58179003-58179025 CAGATGAAGTCACATAGGGTTGG - Intergenic
1150219188 17:63486537-63486559 CAGCTGAGGGCACAGGGGGATGG - Exonic
1150222115 17:63501544-63501566 AAGAAGAGGCAACACGGGGAGGG - Intronic
1150551448 17:66214343-66214365 CAGATGAGGCCAGGTGCGGTGGG - Intronic
1157216679 18:45789467-45789489 CATATGAGGCCACAAGGGTGAGG + Intergenic
1158983500 18:62789120-62789142 CAGATGAGCACACAGGGGGTGGG + Intronic
1159906021 18:74093061-74093083 CAGAAGTGGCAACACAGGGTGGG + Intronic
1160038609 18:75322959-75322981 CAGACGAGGCCACATGGCGGGGG - Intergenic
1161758317 19:6151294-6151316 CAAAAGTAGCCACACGGGGTGGG - Intronic
1163390594 19:17027559-17027581 CTGAGGTGGCCACACGGGGAGGG - Intergenic
1163671227 19:18629888-18629910 GAGATGAGGCCGCACTGGCTTGG - Intergenic
1163749165 19:19065054-19065076 CAGATGGGCCCAAACGCGGTGGG - Intronic
1167618631 19:50549458-50549480 TAGCTGAGGGCACAGGGGGTGGG - Intronic
1167717763 19:51154881-51154903 CAGTTGAGGCCACAGGCTGTGGG + Intergenic
1168008485 19:53510332-53510354 CAGATTAGGGAACTCGGGGTAGG + Intergenic
1168274919 19:55272381-55272403 CAGAAAAGGCCTCACGGTGTGGG + Intronic
925230516 2:2229617-2229639 CAGATGGGGCCTCACTGTGTTGG + Intronic
925317714 2:2938458-2938480 CAGAGGAGGCCACAGGCGGTGGG - Intergenic
925714417 2:6771666-6771688 GAGATGTGTCCACACGGGGTGGG - Intergenic
926616354 2:15000581-15000603 CAGCTGAGTCCACAGGAGGTAGG - Intergenic
927520456 2:23695285-23695307 CAGATCAGGCCACTGGGGGCAGG - Intronic
927520636 2:23696131-23696153 CAGGTGAGGCCCCCCGGGGTTGG + Exonic
928305603 2:30167873-30167895 CAGATGGGGCCTCACAGGGCAGG - Intergenic
929832302 2:45356954-45356976 GAAATGAGGCCACACTGGGCGGG - Intergenic
938378802 2:130825347-130825369 AAGGTGAGGCCACTCGGGGTGGG - Intergenic
938701654 2:133885164-133885186 GTGATGAGGACACACGGGGTGGG + Intergenic
939691407 2:145266448-145266470 CTGATGAGGCCACATGCAGTTGG + Intergenic
941918352 2:170826784-170826806 TACATGAGGCCACATGGGTTTGG + Intronic
944840634 2:203620607-203620629 CACCTGAGGCCCCAGGGGGTGGG - Intergenic
947725824 2:232399688-232399710 TAGAAGAGACCACACTGGGTGGG - Intergenic
947747120 2:232513590-232513612 CAGATGAGGCCACTGAGGCTCGG - Intergenic
1168819488 20:763483-763505 CAGATGAGGGCACACCTGTTAGG + Exonic
1168830401 20:842288-842310 CAGATGGGGCCAGAGGGGCTGGG + Intronic
1169895245 20:10498354-10498376 CCCCTGAGGCCACACTGGGTGGG - Intronic
1171094891 20:22322729-22322751 CAGATAAGGAAACACAGGGTTGG - Intergenic
1172450102 20:35015963-35015985 CAGATGGGGCCTCACTGGCTTGG - Intronic
1173662135 20:44742188-44742210 CACCTAAGGCCACACAGGGTAGG - Intergenic
1176410738 21:6448248-6448270 CTCATCAGGCCACACTGGGTAGG - Intergenic
1178872161 21:36385701-36385723 AAGAGGGGGCCAAACGGGGTAGG - Intronic
1179686232 21:43056570-43056592 CTCATCAGGCCACACTGGGTAGG - Intronic
1180731082 22:17983177-17983199 CAGATTTGGCCACGCGCGGTGGG - Intronic
1181349755 22:22246535-22246557 CAGATGGGGCTACACTGGGCTGG + Intergenic
1181432785 22:22893400-22893422 TAAATGAGGCCAGACGAGGTTGG + Intronic
1183106297 22:35617523-35617545 CAGCTCAGGCCACAGGGGGTGGG + Intronic
1184128890 22:42505473-42505495 CAGCTGAGGCCCCAAGGAGTGGG - Intergenic
1184137685 22:42558788-42558810 CAGCTGAGGCCCCAAGGAGTGGG - Intronic
1185162646 22:49239078-49239100 GCCATGAGGCCAGACGGGGTGGG + Intergenic
1185372751 22:50468544-50468566 CAGATGAGGGCCCAGTGGGTGGG - Intronic
950015930 3:9754883-9754905 AAGGTGAGGCCCCAGGGGGTAGG + Exonic
950194266 3:10998219-10998241 CAGATGAGGCCAGATCTGGTAGG + Intronic
951841225 3:27036226-27036248 AAGATGAGGCCCCACGGTTTTGG + Intergenic
952849121 3:37713370-37713392 CAGCTGAGGCCACACAAAGTTGG + Intronic
955553503 3:60110139-60110161 CATATGAGGACACGGGGGGTTGG + Intronic
955760827 3:62280286-62280308 CAGATGAGGACACAAGGCCTTGG - Intronic
961450040 3:126998550-126998572 CTGGTGAGGCCACACCTGGTGGG - Intronic
967086051 3:186096266-186096288 CAGATGAGGAAACTAGGGGTAGG + Intronic
968454079 4:688491-688513 CTGATGAGGGCACACAGGGCGGG + Intronic
968753617 4:2403129-2403151 CAGCTGGGGCCACACAGGCTTGG - Intronic
969051934 4:4379388-4379410 CAGATGAGGCCACCGAGGCTTGG - Intronic
969108671 4:4827806-4827828 AAGATGAGGTCACACTGGATTGG + Intergenic
969550927 4:7866748-7866770 CAAATGAGGCCAGGTGGGGTGGG + Intronic
969695388 4:8731351-8731373 CAGATGAGGACACTGGGGCTTGG + Intergenic
969728679 4:8940493-8940515 CTGCCGAGGCCACACGGGGTGGG - Intergenic
970492083 4:16584957-16584979 CAGCTGAGGACACACAGTGTGGG + Intronic
976469272 4:85408485-85408507 CAGAAGAGGCCACAGGAGATTGG + Intergenic
979838322 4:125403246-125403268 CAGATGAGGAAACATGGGCTTGG + Intronic
980070939 4:128242490-128242512 CAGATCAGGCAACGCGGGGAGGG + Intergenic
985090768 4:186360595-186360617 CAAGGGAGGCCACACAGGGTAGG - Intergenic
985621594 5:958981-959003 CCGATGAGTCCACACGTGGGCGG + Intergenic
985634312 5:1028483-1028505 GGGATGAGGCCCCACGGGGCAGG + Intronic
985696017 5:1340602-1340624 CAGATGAGGGGACACGGAGAGGG + Intronic
986195942 5:5536505-5536527 CAGATGAGGCGAGAGGTGGTAGG + Intergenic
990937116 5:61162646-61162668 CAGGTGAGGCCGCGCGGGGCGGG + Intergenic
995705331 5:114983092-114983114 AAGATGAGGCCATAGGGGTTAGG - Intergenic
996923531 5:128796615-128796637 AAGATGAGGCTACAAGAGGTAGG - Intronic
999614692 5:153410257-153410279 CAGATGAAGCCACAGGGGTTAGG + Intergenic
999657443 5:153824704-153824726 CAGATGAGGAAACACAGGCTCGG + Intergenic
1001447133 5:171794356-171794378 CGGAAGTGGCCACATGGGGTAGG - Intronic
1001935015 5:175697507-175697529 GAGATGAGGCTGCAGGGGGTGGG - Intergenic
1002183095 5:177441556-177441578 CAGCTCAGGCCACACGTGGGTGG - Intronic
1006257522 6:32843686-32843708 AAGAAGAGGCCACATGGGGATGG - Intronic
1007236625 6:40395058-40395080 CAGAAGAGGCCAGAGGGGTTAGG + Intronic
1010398856 6:75425696-75425718 CAGATGAGGACACTGTGGGTTGG - Intronic
1016243311 6:141956394-141956416 CAGCTGATGCCACTGGGGGTAGG - Intergenic
1017976084 6:159358680-159358702 CTGATGAGGCCACCCCTGGTGGG + Intergenic
1019414208 7:919948-919970 CAGGTGAGGCCACCCGGGTGGGG - Exonic
1020254079 7:6492154-6492176 TAAATGAGGCCACATGGGGAGGG + Intergenic
1021953186 7:25796195-25796217 CAGGGGAGGCCACAGGGGGAGGG + Intergenic
1023252541 7:38280896-38280918 CAGATTGGACCACACAGGGTTGG + Intergenic
1029929256 7:104353334-104353356 CAGATGAGACCACATGAGGATGG + Intronic
1030909484 7:115229021-115229043 GAGATGGGGACACACTGGGTGGG + Intergenic
1034163675 7:149010202-149010224 TAAATAAGGCCACACGGGCTGGG + Intronic
1034994818 7:155570958-155570980 CAGATGTGGCGACATGGGGTAGG - Intergenic
1035392072 7:158510968-158510990 CATGTGAGGTCACATGGGGTTGG + Intronic
1035657760 8:1323637-1323659 CAGAAGAGGCCACAGGGCATTGG - Intergenic
1035751817 8:2001863-2001885 CAGCTGCGGCCCCACGGCGTCGG - Exonic
1037309270 8:17537350-17537372 CAGTAGAAGCCACACAGGGTGGG - Intronic
1037813067 8:22098032-22098054 GAGATGAGGCCAGACCTGGTGGG - Intronic
1040557364 8:48492772-48492794 TAGATGAGGCCAGGCGTGGTGGG + Intergenic
1041411831 8:57564819-57564841 CAGATGAGGCCAGAGGGAGCAGG - Intergenic
1047089899 8:121562168-121562190 CAGAAGAGGCTACAGGGGGCAGG + Intergenic
1048579579 8:135719912-135719934 CAGGGGAGGCCACAGGGGATTGG + Intergenic
1049173618 8:141177509-141177531 CAGATGGGGCCACAGCGGGAGGG + Intronic
1049371637 8:142270779-142270801 CAGCTGCTGCCACATGGGGTTGG + Intronic
1049443130 8:142618215-142618237 CAGATGAGGCCACAAGGCTGGGG - Intergenic
1049574652 8:143384586-143384608 CAGCTGAAGCCACACGTGGCTGG + Intergenic
1050272303 9:3959245-3959267 CACGTGAGGACACACGGAGTGGG + Intronic
1052348100 9:27430207-27430229 CTGCTGAGGCCACAAGGGATTGG + Intronic
1052442977 9:28521763-28521785 CAGATGAGGTCATACTGGATTGG + Intronic
1053271388 9:36751993-36752015 CAGATGCGGCCACACCCAGTGGG - Intergenic
1056109516 9:83381033-83381055 CAGAAGAGGCCAGAGGGGCTAGG - Intronic
1057761157 9:97875451-97875473 CAGAAGAGGCCTCACGGAGGAGG + Intergenic
1057928481 9:99172933-99172955 CAGGAGAGGCCAAACGGAGTAGG + Intergenic
1058439442 9:104993459-104993481 CAGCTGAGGCACCAAGGGGTTGG - Intergenic
1060923295 9:127437816-127437838 AAAATGAGGCCACACTGGATTGG - Intronic
1061678194 9:132229984-132230006 CAGCTGAGGACACACGGCTTGGG - Intronic
1062173558 9:135148554-135148576 CAGATGGAGACACACAGGGTAGG - Intergenic
1062178256 9:135176306-135176328 CAGAGGAGGCTCCACGGTGTGGG + Intergenic
1062193950 9:135263091-135263113 CAGAGGAGTCCCCACGGGCTGGG + Intergenic
1062562134 9:137146361-137146383 CAGGGGAGGCCACGCGGGGGAGG - Intronic
1062563497 9:137152200-137152222 CAGAAGAGGCCACAAGTGGCTGG - Intronic
1185859230 X:3562105-3562127 CACAAGAGGCCACACAGTGTAGG - Intergenic
1188584449 X:31756145-31756167 CAGATGAGCCCCCAGAGGGTGGG - Intronic
1189441666 X:41041825-41041847 CAAAAGAAGACACACGGGGTTGG + Intergenic
1190502771 X:51095883-51095905 CAGATGAGGCAGCACTGGGCAGG + Intergenic
1199210243 X:145199963-145199985 GTGAAGAGGCCACAGGGGGTAGG - Intergenic