ID: 1076354021

View in Genome Browser
Species Human (GRCh38)
Location 10:129839485-129839507
Sequence ACAGATGAGGCCACACGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076354021_1076354030 1 Left 1076354021 10:129839485-129839507 CCACCCCGTGTGGCCTCATCTGT No data
Right 1076354030 10:129839509-129839531 GACAGCTGTGCCCTCGGGGCCGG No data
1076354021_1076354027 -5 Left 1076354021 10:129839485-129839507 CCACCCCGTGTGGCCTCATCTGT No data
Right 1076354027 10:129839503-129839525 TCTGTGGACAGCTGTGCCCTCGG No data
1076354021_1076354029 -3 Left 1076354021 10:129839485-129839507 CCACCCCGTGTGGCCTCATCTGT No data
Right 1076354029 10:129839505-129839527 TGTGGACAGCTGTGCCCTCGGGG No data
1076354021_1076354028 -4 Left 1076354021 10:129839485-129839507 CCACCCCGTGTGGCCTCATCTGT No data
Right 1076354028 10:129839504-129839526 CTGTGGACAGCTGTGCCCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076354021 Original CRISPR ACAGATGAGGCCACACGGGG TGG (reversed) Intronic
No off target data available for this crispr