ID: 1076354023

View in Genome Browser
Species Human (GRCh38)
Location 10:129839488-129839510
Sequence TCCACAGATGAGGCCACACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076354023_1076354027 -8 Left 1076354023 10:129839488-129839510 CCCCGTGTGGCCTCATCTGTGGA No data
Right 1076354027 10:129839503-129839525 TCTGTGGACAGCTGTGCCCTCGG No data
1076354023_1076354028 -7 Left 1076354023 10:129839488-129839510 CCCCGTGTGGCCTCATCTGTGGA No data
Right 1076354028 10:129839504-129839526 CTGTGGACAGCTGTGCCCTCGGG No data
1076354023_1076354030 -2 Left 1076354023 10:129839488-129839510 CCCCGTGTGGCCTCATCTGTGGA No data
Right 1076354030 10:129839509-129839531 GACAGCTGTGCCCTCGGGGCCGG No data
1076354023_1076354029 -6 Left 1076354023 10:129839488-129839510 CCCCGTGTGGCCTCATCTGTGGA No data
Right 1076354029 10:129839505-129839527 TGTGGACAGCTGTGCCCTCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076354023 Original CRISPR TCCACAGATGAGGCCACACG GGG (reversed) Intronic
No off target data available for this crispr