ID: 1076354024

View in Genome Browser
Species Human (GRCh38)
Location 10:129839489-129839511
Sequence GTCCACAGATGAGGCCACAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 207}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076354024_1076354027 -9 Left 1076354024 10:129839489-129839511 CCCGTGTGGCCTCATCTGTGGAC 0: 1
1: 0
2: 2
3: 22
4: 207
Right 1076354027 10:129839503-129839525 TCTGTGGACAGCTGTGCCCTCGG No data
1076354024_1076354029 -7 Left 1076354024 10:129839489-129839511 CCCGTGTGGCCTCATCTGTGGAC 0: 1
1: 0
2: 2
3: 22
4: 207
Right 1076354029 10:129839505-129839527 TGTGGACAGCTGTGCCCTCGGGG No data
1076354024_1076354030 -3 Left 1076354024 10:129839489-129839511 CCCGTGTGGCCTCATCTGTGGAC 0: 1
1: 0
2: 2
3: 22
4: 207
Right 1076354030 10:129839509-129839531 GACAGCTGTGCCCTCGGGGCCGG No data
1076354024_1076354028 -8 Left 1076354024 10:129839489-129839511 CCCGTGTGGCCTCATCTGTGGAC 0: 1
1: 0
2: 2
3: 22
4: 207
Right 1076354028 10:129839504-129839526 CTGTGGACAGCTGTGCCCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076354024 Original CRISPR GTCCACAGATGAGGCCACAC GGG (reversed) Intronic
900390995 1:2433855-2433877 CTCCACGGATGTGCCCACACTGG + Intronic
900869560 1:5292355-5292377 GTCCAAGGATGACCCCACACAGG + Intergenic
901219477 1:7575050-7575072 TTCTACAGATGAGACCACAGAGG - Intronic
901431395 1:9217248-9217270 CCCCACAGATGAGGCCCCAAAGG - Intergenic
901771465 1:11532366-11532388 TTCTACAGATGAGGCCAGAGGGG - Intronic
902227278 1:15004485-15004507 GTTCACAGGTGAGGCAACTCAGG - Intronic
903437579 1:23362981-23363003 GTCCACAAAGAAGTCCACACAGG - Exonic
904562662 1:31409216-31409238 GTCAGCAGATGAGCCCACAGTGG - Intergenic
905371342 1:37484073-37484095 GAGCACAGATGAGGCCTCATTGG - Exonic
906211832 1:44016494-44016516 GTCCAGGGATGAGGACACACCGG + Intronic
906525966 1:46493460-46493482 GTCCACCCATCAGGCAACACTGG - Intergenic
907828483 1:58041133-58041155 CTTCACAGATGAGGAGACACTGG - Intronic
908790808 1:67779459-67779481 GTCCAGGCATGAGGCCACAGGGG - Intronic
910880335 1:91917400-91917422 CTCCCAAGATGAGGCCACTCAGG + Intergenic
912510788 1:110188913-110188935 GTCCACGCAGGAGGCCACAGGGG - Intronic
915152998 1:153850122-153850144 ATCCACAGTTTAAGCCACACAGG - Intronic
917222694 1:172748680-172748702 TTCCACTGATGGAGCCACACAGG - Intergenic
918238624 1:182603002-182603024 ATCCACGGATGAGGGCACACAGG - Intronic
919088845 1:192953653-192953675 ATCCTCAGAGGAGGCCACTCAGG + Intergenic
920238789 1:204528641-204528663 GACCAGGGCTGAGGCCACACAGG - Intronic
922859550 1:228804540-228804562 GCCCACAGCTGGGGCTACACAGG + Intergenic
1062898900 10:1126623-1126645 GTCCACAGAAGGAGCCACAGAGG - Intronic
1063300856 10:4847738-4847760 GTTCAGAGTAGAGGCCACACAGG - Exonic
1067735378 10:48846380-48846402 GCCCACAGAGGAGGCCACACCGG - Intronic
1067739438 10:48883257-48883279 GTCCAGGGATAAGGCCACAGTGG - Intronic
1069715579 10:70519069-70519091 TTCCACAGATGAGGCAACTGAGG - Intronic
1070825635 10:79388848-79388870 TTCCACAGATGAGGCAACTGAGG + Intronic
1071507735 10:86242810-86242832 GGCCACAGATGAGGAAACTCAGG + Intronic
1072694074 10:97590248-97590270 ATCCACTGATGAGGCCACGTGGG + Exonic
1073610356 10:104937023-104937045 TTCCACAGATGGGGGCACAGGGG + Intronic
1075931590 10:126301431-126301453 GTCCCCAAATGAAGACACACTGG + Intronic
1076354024 10:129839489-129839511 GTCCACAGATGAGGCCACACGGG - Intronic
1076423503 10:130351157-130351179 GGCTGCAGATCAGGCCACACAGG + Intergenic
1076570909 10:131432364-131432386 GTCTTCAGATGAGGCCAACCAGG + Intergenic
1076774820 10:132689333-132689355 GGCCAGAGAGGAGGGCACACGGG - Intronic
1077850028 11:6067205-6067227 GTCCACAGTGGTGGCCTCACAGG + Intergenic
1077917802 11:6622493-6622515 AGCCAGAGAGGAGGCCACACTGG + Exonic
1078132341 11:8623199-8623221 CTCCTCAGAGGAGGCAACACTGG - Intronic
1078440116 11:11357691-11357713 GTTTACAGATGAGGCCACTGAGG - Intronic
1079095225 11:17505667-17505689 GCCAAGAGATGAGGCCACATGGG - Intronic
1085743669 11:79097110-79097132 TTTCACAGATGAGGACACAGAGG + Intronic
1089286049 11:117408889-117408911 GGCCTCAGATGAGGGCACTCTGG + Exonic
1089787148 11:120915849-120915871 TTCCACAGATGAGGGCACAGAGG + Intronic
1091618653 12:2068747-2068769 GTTTCCAGATGAGGCCAGACGGG - Intronic
1091657600 12:2356839-2356861 TTCCACAGATGAGGCCGCTGGGG + Intronic
1092364098 12:7862472-7862494 GTCCGCACAGGAGGCCACAGAGG - Intronic
1095998292 12:48107755-48107777 TCCCACAGATGAGCCCAGACTGG - Intronic
1096004746 12:48160255-48160277 CTGCACACATGAGGGCACACAGG - Intronic
1096472584 12:51888779-51888801 CTCCCCAGAGGAGGCCACCCAGG + Exonic
1100230131 12:92598998-92599020 GACCACAGGTTAGGCAACACTGG + Intergenic
1100291455 12:93218647-93218669 GTCCAAAGACGAGGAGACACTGG + Intergenic
1101962480 12:109260262-109260284 CTTCACAGATGAGGCCACTGAGG + Intronic
1102036137 12:109771494-109771516 GTCCACAGAAGAGGAAACAGAGG + Intergenic
1102199960 12:111050321-111050343 GGATACAGATGAGGTCACACAGG - Intronic
1103123745 12:118402968-118402990 GTCAACAGATGAGACCATCCTGG - Intronic
1103184516 12:118944912-118944934 GTCCACAGATGAGGATACTGAGG - Intergenic
1104212046 12:126698545-126698567 GTCCACATATGAGCACACATAGG + Intergenic
1104802944 12:131566982-131567004 ATCCACAGTTGAGCCCTCACGGG - Intergenic
1108680762 13:52778375-52778397 TTCCACAGGTGAGGCTACAGAGG - Intergenic
1109827803 13:67745531-67745553 GTACACAGCTGAGGGCACACTGG - Intergenic
1110209400 13:72954095-72954117 GTGCACAGAAGAATCCACACAGG + Intronic
1110338635 13:74363169-74363191 GACCACAGATGAGACAGCACCGG - Intergenic
1113858141 13:113460739-113460761 GTCCTCAGAGGAGACAACACGGG + Intronic
1113961042 13:114126273-114126295 GTTGACAGAAGGGGCCACACGGG - Intronic
1114035565 14:18623917-18623939 TTCCACTGATGGGTCCACACTGG + Intergenic
1114123072 14:19691105-19691127 TTCCACTGATGGGTCCACACTGG - Intergenic
1117203713 14:53418703-53418725 CTCCACACAAGAGTCCACACTGG + Intergenic
1119549230 14:75496401-75496423 GCCTACAGATGAGGCCACTGAGG + Intergenic
1121942677 14:98087793-98087815 TTCCAAAAATGAGGCCACACTGG + Intergenic
1122059777 14:99129303-99129325 GGCCTCAGAGGAGGTCACACAGG - Intergenic
1122316924 14:100831221-100831243 CTCCACAGATTGGGCCCCACTGG + Intergenic
1122472368 14:101978749-101978771 GCCCACAGAAGAGGTCACACTGG + Intronic
1123207220 14:106725159-106725181 GTGCACAGGTGAGGTCTCACAGG - Intergenic
1123212244 14:106772162-106772184 GTGCACAGGTGAGGTCTCACAGG - Intergenic
1202835681 14_GL000009v2_random:76088-76110 TCCCACAGATGAAGCCCCACTGG - Intergenic
1126911300 15:53419769-53419791 GTCCACAGATGAGGTCCCTCAGG + Intergenic
1132803716 16:1766263-1766285 GTCCACAGAGGAGGCCACAGAGG + Exonic
1133880215 16:9774627-9774649 GTTTACAGATGAGGGCACGCAGG + Intronic
1134062392 16:11206891-11206913 GTCAAGAGATGAGACCACTCAGG - Intergenic
1135989336 16:27208237-27208259 GACCAAACATGAGGCCACCCTGG + Intronic
1136129575 16:28211538-28211560 GTCCCCCGATGAGGCGACCCGGG - Exonic
1137580791 16:49632399-49632421 GTCCCCAGGTGTGCCCACACAGG + Intronic
1139359785 16:66390433-66390455 GCCCACAGAGGTGCCCACACGGG - Exonic
1139655522 16:68384880-68384902 GGCCTCAGATGAGGCCATTCTGG - Intronic
1139666939 16:68463911-68463933 GACCACAGATTTGGCCTCACAGG - Intergenic
1140377089 16:74453208-74453230 GTCCACACATCAGGCCAATCAGG + Exonic
1141698843 16:85633244-85633266 TCCCAGAGATGGGGCCACACAGG - Intronic
1144210559 17:13011438-13011460 GTCCACAGTTTTGGCCACCCAGG - Intronic
1147381716 17:40060223-40060245 GAGGACAGATGAGGCAACACAGG + Intronic
1148391159 17:47274187-47274209 CTCAACTGATGAGGCCACAGTGG - Intronic
1148516527 17:48223508-48223530 GTTCACAGATGATGCCAAAAGGG - Intronic
1152125762 17:78445591-78445613 GTCCACTGGTGAGACCACTCCGG + Exonic
1153754009 18:8261979-8262001 GTCCGCAGATGCTGGCACACGGG - Intronic
1154377581 18:13822747-13822769 GGCCACAGATGAGGGCTCCCAGG + Intergenic
1157666447 18:49491791-49491813 TTCCACAGAAGTAGCCACACGGG + Exonic
1157712933 18:49862485-49862507 GTTCACAGATGAGGCAACTGAGG + Intronic
1158835142 18:61322701-61322723 CTCCACAGATGAGGACAGCCAGG - Intergenic
1159758367 18:72393971-72393993 CTCCTCTGATGAGGCCACTCTGG - Intergenic
1160820810 19:1056903-1056925 GTCCACCGAGGAGGCCATCCTGG - Exonic
1164535308 19:29081735-29081757 GTCCAGAGATGAGACCATCCTGG + Intergenic
1164535933 19:29086676-29086698 GTCCACAGAAGAGGAAACCCAGG - Intergenic
1165645700 19:37434088-37434110 GTCAACAGATGAGACCATTCTGG + Intronic
1165700435 19:37933163-37933185 GGTCACAGATGAGGTCACACAGG - Intronic
1166336582 19:42111905-42111927 GTCCAGAGAAGAACCCACACTGG - Intronic
1166420563 19:42633046-42633068 CTCCACAGAAGAGAACACACAGG - Intronic
1166471437 19:43082581-43082603 CTCCACAGAGGAGAACACACAGG - Exonic
1166492208 19:43269443-43269465 CTCCACAGAGGAGAACACACAGG - Exonic
1167597560 19:50435541-50435563 GTCCACAGATGAGGAAACCGAGG + Intronic
1167773705 19:51541199-51541221 GACCACAGATGAGGAGAGACAGG - Intergenic
925696598 2:6586526-6586548 ATACACAGATGAGGGCACAGAGG - Intergenic
925909656 2:8565532-8565554 GGACACAGATGAGACCGCACGGG - Intergenic
926484588 2:13438755-13438777 GTTCACAGATCAGCCCACAGTGG - Intergenic
926532084 2:14060800-14060822 GTCAATAGATGTGGCTACACTGG - Intergenic
926561282 2:14420108-14420130 GGCCATAGATGAGGTCATACTGG + Intergenic
927161553 2:20267694-20267716 TTCCACAGATGAGGTCACTATGG + Intronic
929098333 2:38285431-38285453 GTCAACAGATTTGGCCACATTGG + Intergenic
929268616 2:39947265-39947287 GCCCACAGAGGAGTCCACATTGG + Intergenic
929818085 2:45251837-45251859 ATCCAAAGAGGAGACCACACAGG + Intergenic
929869149 2:45743621-45743643 GTACACAGATGTGGCCAGGCAGG - Intronic
930269197 2:49235935-49235957 GTCCACAGAAGAAGCCACTCTGG - Intergenic
931241740 2:60460615-60460637 GTCCACAGGAGAAGCCACACGGG - Exonic
938378602 2:130824222-130824244 TTTCACAGATGAGGCCACAGAGG - Intergenic
938719735 2:134055909-134055931 GAGCACAGATGAGGCCCCTCTGG + Intergenic
939199724 2:139018569-139018591 GCACACAGATGTGGCCAGACTGG + Intergenic
944912463 2:204323955-204323977 GTGCACATGTGAGGCCACTCTGG + Intergenic
945262983 2:207862052-207862074 GCCCACAGGTGAGGCCACTGTGG - Intronic
947839914 2:233201227-233201249 CTCCAAAGAGGTGGCCACACAGG - Intronic
948238420 2:236408273-236408295 TGCCACAGAGAAGGCCACACAGG + Intronic
1169135138 20:3192685-3192707 GTCCACCGCTGTGTCCACACAGG + Intronic
1169688550 20:8304574-8304596 GTCCACAGAAGAGGCCCCTCAGG - Intronic
1172629410 20:36367918-36367940 GTTCACAGATGAGGAAACAGAGG + Intronic
1173616081 20:44403790-44403812 TTCCACAGATGAGGACACTGAGG - Intronic
1173869079 20:46330530-46330552 GGCCACAGAGGGGGCCACTCAGG - Intergenic
1174160132 20:48544631-48544653 GTTTACAGATGAGGACACTCAGG - Intergenic
1174299860 20:49573650-49573672 TTCCACAGAGGATGTCACACTGG - Intergenic
1175169002 20:57066809-57066831 GATTACAGATGAGGCCAAACTGG + Intergenic
1176248657 20:64109620-64109642 GCCCAGAGCTCAGGCCACACGGG - Intergenic
1179804652 21:43829542-43829564 GGCATCAGATGAGTCCACACAGG + Intergenic
1180459687 22:15550971-15550993 TTCCACTGATGGGTCCACACTGG + Intergenic
1181271272 22:21660256-21660278 GGCCATATATGTGGCCACACAGG + Intronic
1182423896 22:30261964-30261986 TTCCACAGATGAGGAAACAAAGG + Intergenic
1183238474 22:36638073-36638095 GTCCACACATGAACCCACAGAGG - Intronic
1184034599 22:41912481-41912503 GCCCAGAGATGAGGCCACAGAGG - Intronic
1184073897 22:42163925-42163947 GGCCACGGATGAGGCCAAAGGGG - Intronic
1184556439 22:45235793-45235815 GTCTACAGATGAGGACACTGAGG + Intronic
1184627157 22:45744170-45744192 GTCCCCAGATGATGCCAGAATGG - Intronic
1184886942 22:47352248-47352270 TTCCACAGATGAGGCCAGGCAGG - Intergenic
1185281175 22:49970568-49970590 GTGTACAGATGTGGACACACAGG - Intergenic
1185340320 22:50288062-50288084 GACCACAGCAGAGGCCGCACGGG + Intronic
949684366 3:6551283-6551305 ATCCACTAATGAGGCCACACTGG - Intergenic
953759030 3:45672485-45672507 ATACACAGAAGAGACCACACAGG - Intronic
954714362 3:52519681-52519703 GTGCACACATGAGTTCACACAGG - Intronic
955389742 3:58512632-58512654 GAACACAGAAGAGGCCACAGGGG - Intronic
958171731 3:89947551-89947573 CTGCACAGAAGAGGTCACACAGG - Intergenic
965176899 3:165346433-165346455 GACCAAAGATGAGGCCACTGTGG - Intergenic
965673752 3:171173692-171173714 TTCCACAGAGGAGGACAAACTGG - Intronic
966932728 3:184686294-184686316 TTTCACAAATGAGGCCACAGAGG + Intergenic
967069106 3:185946542-185946564 TTTCACAGATGAAGCCACAGAGG - Intergenic
967889729 3:194356631-194356653 GTCCTCAGATGACACCACCCAGG - Intronic
968277870 3:197454747-197454769 TTCCACAGATGTGGCAAAACAGG + Intergenic
968902181 4:3436943-3436965 ATCCAGACCTGAGGCCACACTGG - Intronic
970511287 4:16784338-16784360 GTCTACAGATGAGGAAACAGAGG - Intronic
976117585 4:81744319-81744341 GGCCACAGATGAGGAGGCACAGG - Intronic
977827492 4:101551129-101551151 GTCCTCAGATGAGGTCCCAGAGG + Intronic
984647292 4:182233284-182233306 GTCCACACATGATCCCACACTGG + Intronic
985200674 4:187481808-187481830 GGTCACTGATGAGGCCTCACTGG - Intergenic
985605741 5:857283-857305 ATCCACAGATGGGGGCAGACAGG - Intronic
986338227 5:6770244-6770266 GGCCTGAGGTGAGGCCACACAGG + Intergenic
986468096 5:8047256-8047278 GTTCAGAGACAAGGCCACACTGG - Intergenic
987559735 5:19504525-19504547 TTCCTCAGATGAGGCAGCACTGG - Intronic
989152140 5:38310345-38310367 GTACACAGATGAGGAAACTCTGG - Intronic
991220042 5:64203211-64203233 CTCCTCAGATCAGGCTACACTGG - Intronic
991596564 5:68312909-68312931 CTCCACCGATGAGAGCACACTGG + Intergenic
998063367 5:139136675-139136697 GTCCACAGATGAAGACATAGAGG + Intronic
999342375 5:150783241-150783263 GTTCCTAGATGGGGCCACACTGG - Intronic
1000247317 5:159459457-159459479 GTCCACAGCTGATGCGACAGTGG - Intergenic
1000339798 5:160268375-160268397 TTTCACAGATGAGGAAACACAGG - Intronic
1002714464 5:181217804-181217826 GTTTACAGATGAGGCCACTGAGG - Intergenic
1002921567 6:1576878-1576900 CCCCACAGATGATGCCACACGGG - Intergenic
1004423530 6:15492342-15492364 TTCCACAGAAGAGCACACACAGG - Intronic
1004585676 6:16997527-16997549 GTCCAGAGATGAGGCAAAACAGG + Intergenic
1006393293 6:33771513-33771535 TGCCGCAGATGAGGACACACGGG + Exonic
1007761567 6:44136345-44136367 GTGCATAGCTGAAGCCACACTGG - Exonic
1010400251 6:75440582-75440604 GACCACAGGTGAGGGCTCACTGG + Intronic
1016850649 6:148615526-148615548 GTCAAGAGAAGAGGCCACACTGG + Intergenic
1017159478 6:151351433-151351455 CACCACAGAGGAGGCCACTCCGG + Exonic
1017630204 6:156389540-156389562 GTCCACAAGGGAGGCCTCACCGG + Intergenic
1017816544 6:158020302-158020324 GTCCACAGTTGGAGTCACACAGG - Intronic
1018060300 6:160084746-160084768 GTCCACACCTGCGGCCACCCTGG - Intronic
1018331609 6:162733755-162733777 ATCAAGAGATGAGGACACACAGG - Intronic
1018381168 6:163259756-163259778 GGCCACAGATGGGGCAACATGGG - Intronic
1018733461 6:166670022-166670044 ATCCAGAGATGAGGGCACTCAGG + Intronic
1019311633 7:364738-364760 TTTCACAGATGAGGCCACCGAGG + Intergenic
1019553501 7:1616935-1616957 GTTCACAGATGAGGAAACAGAGG - Intergenic
1022399412 7:30023177-30023199 TTGCACAGATGAGGAAACACAGG + Intronic
1023034260 7:36116921-36116943 TTTCACAGATGAGGACACTCAGG - Intergenic
1023491889 7:40751734-40751756 GTTTACAGATGAGGTCATACAGG + Intronic
1023607274 7:41942150-41942172 TTCCACAGATGAGGAAACAGAGG + Intergenic
1023975707 7:45028273-45028295 GTGCCCACAGGAGGCCACACTGG - Intronic
1024529197 7:50376772-50376794 GTTCACAAAAGAAGCCACACTGG + Exonic
1024980528 7:55154150-55154172 GCCCACAGAGGAGGACTCACGGG - Exonic
1027182120 7:75948179-75948201 AGCTACAGATGAGGCCACACGGG - Intronic
1030473514 7:109998830-109998852 TGCCACAGAGAAGGCCACACAGG + Intergenic
1031489357 7:122368481-122368503 GTTCACAGATGAGGAAACAGAGG - Intronic
1031842273 7:126758339-126758361 ATCCAAAGATGAGGCCATAAAGG + Intronic
1034337732 7:150334219-150334241 GGGCACAGGTGAGGCCACAGTGG - Intronic
1034860506 7:154591123-154591145 GTGCAAAGACGAGGCCACAAGGG + Intronic
1035672915 8:1433715-1433737 ATACACAGATGAGGCAAAACTGG + Intergenic
1036778236 8:11628313-11628335 GTCCACAGTGGGGGGCACACTGG - Intergenic
1039459284 8:37729823-37729845 TTTCACAGATAAGGACACACAGG - Intergenic
1041094606 8:54336870-54336892 TGCCACATCTGAGGCCACACAGG + Intergenic
1042798742 8:72693661-72693683 GTCCACAGATAAGGTTAAACTGG - Intronic
1045347406 8:101305421-101305443 GTTCACAGATGAGGACACTGAGG - Intergenic
1048192282 8:132300810-132300832 CTCTACAGATGAGCCCACAAGGG - Intronic
1049705851 8:144041616-144041638 GTCCACAGAGGAGGCCATCCTGG - Intronic
1051711411 9:19934585-19934607 GTGCACAGCAGAGGCCAAACAGG + Intergenic
1052818967 9:33123976-33123998 TCCCACAGATGAGGCCAGGCTGG - Intronic
1053415795 9:37946109-37946131 GTGCACAGATGAGGACACTGAGG + Intronic
1055882765 9:81021667-81021689 GTGCACAGAAAATGCCACACAGG + Intergenic
1056968764 9:91185674-91185696 GCCCAGAGATGAGGCCCCTCAGG + Intergenic
1057480556 9:95442007-95442029 ATTTACAGATGAGGACACACAGG + Intergenic
1057819035 9:98317196-98317218 GTCCAGCAGTGAGGCCACACCGG + Intronic
1058977601 9:110138878-110138900 GTCCACACATGGGTCCACTCTGG - Intronic
1060268147 9:122124201-122124223 GTGCACAGCTGAGGCCACCCAGG - Intergenic
1061267992 9:129519370-129519392 TTACACAGATGAGGCCACCGAGG - Intergenic
1062711879 9:137979373-137979395 GACCACAGCTGAGGACACTCCGG - Intronic
1189451656 X:41138608-41138630 GTCAAAAGTTGAGGCCACAGAGG - Intronic
1190319605 X:49172353-49172375 GTCCACTGATGAGTTCACGCAGG - Intronic
1196746322 X:119073951-119073973 GCCCACAGAGGAGGCCGCAGAGG + Intergenic
1196950855 X:120874944-120874966 GCTCACAGAGGAGGCCACAGAGG - Exonic
1197723156 X:129758663-129758685 GTTCACAGATGAGGCCATTGAGG - Intronic
1199574112 X:149296929-149296951 TTGTACAGATGAGGCCACAGAGG - Intergenic