ID: 1076354025

View in Genome Browser
Species Human (GRCh38)
Location 10:129839490-129839512
Sequence TGTCCACAGATGAGGCCACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 251}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076354025_1076354028 -9 Left 1076354025 10:129839490-129839512 CCGTGTGGCCTCATCTGTGGACA 0: 1
1: 0
2: 1
3: 14
4: 251
Right 1076354028 10:129839504-129839526 CTGTGGACAGCTGTGCCCTCGGG No data
1076354025_1076354030 -4 Left 1076354025 10:129839490-129839512 CCGTGTGGCCTCATCTGTGGACA 0: 1
1: 0
2: 1
3: 14
4: 251
Right 1076354030 10:129839509-129839531 GACAGCTGTGCCCTCGGGGCCGG No data
1076354025_1076354029 -8 Left 1076354025 10:129839490-129839512 CCGTGTGGCCTCATCTGTGGACA 0: 1
1: 0
2: 1
3: 14
4: 251
Right 1076354029 10:129839505-129839527 TGTGGACAGCTGTGCCCTCGGGG No data
1076354025_1076354027 -10 Left 1076354025 10:129839490-129839512 CCGTGTGGCCTCATCTGTGGACA 0: 1
1: 0
2: 1
3: 14
4: 251
Right 1076354027 10:129839503-129839525 TCTGTGGACAGCTGTGCCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076354025 Original CRISPR TGTCCACAGATGAGGCCACA CGG (reversed) Intronic
901001103 1:6149169-6149191 TGCCCCCAAATGAGGGCACAGGG + Intronic
901771466 1:11532367-11532389 CTTCTACAGATGAGGCCAGAGGG - Intronic
902544205 1:17176743-17176765 TGTCAACAGTAGAGGCCATATGG + Intergenic
902722964 1:18316278-18316300 TGACCACTGCTGAGGCCAGAGGG + Intronic
903282532 1:22258084-22258106 TGTGCACAGGTGACGCCACGGGG + Intergenic
904163499 1:28537935-28537957 TGGACACAGATAAGACCACACGG - Exonic
904926078 1:34049213-34049235 TGTCTACAGATGAGGCCCACAGG - Intronic
905284485 1:36870331-36870353 TGACCACAAAGCAGGCCACATGG + Intronic
905392169 1:37643662-37643684 TGTCCACAGGTGATGGCACCAGG - Intergenic
907827568 1:58033414-58033436 TTTCCAAAGATGAGGGCATAAGG - Intronic
908376914 1:63552339-63552361 TGTTCACACATGAGGCATCAGGG - Intronic
908790809 1:67779460-67779482 AGTCCAGGCATGAGGCCACAGGG - Intronic
909351427 1:74657715-74657737 TGTTCACAGATGAGGCAATGGGG + Intronic
909841035 1:80324357-80324379 TCTCCATAGAGGAGGCCAAATGG - Intergenic
911108063 1:94152872-94152894 TTTTCACAGATGAAGACACATGG - Intronic
912072714 1:105832549-105832571 AGACCACATATGAGGCCAGAGGG + Intergenic
912510789 1:110188914-110188936 AGTCCACGCAGGAGGCCACAGGG - Intronic
913240905 1:116828377-116828399 TGTGCACATATGAGGGCAGAGGG + Intergenic
913582927 1:120244990-120245012 TGTTTACAGATGAGGAAACAAGG - Intergenic
913625245 1:120653370-120653392 TGTTTACAGATGAGGAAACAAGG + Intergenic
914564858 1:148856486-148856508 TGTTTACAGATGAGGAAACAAGG - Intronic
914607968 1:149273756-149273778 TGTTTACAGATGAGGAAACAAGG + Intergenic
915553781 1:156650020-156650042 TGTCCACAGATCTGTCCAAATGG - Intronic
915900198 1:159841191-159841213 TGTGCACAGCTGTGGGCACAAGG + Exonic
916391592 1:164336833-164336855 TGTCCTCCTATGAGGCCATAGGG - Intergenic
918115191 1:181490143-181490165 TTTCCAGAGATGAGGACACTGGG - Intronic
919689770 1:200518683-200518705 TTTCCACTGATGATGTCACAGGG - Intergenic
919776892 1:201200075-201200097 TGACCACTGTTGAGGCCAGAAGG - Intronic
920317108 1:205084492-205084514 TATAAACAGGTGAGGCCACAAGG + Intergenic
921511429 1:216035312-216035334 TGTACACAGATAAGCACACAGGG + Intronic
922122010 1:222680621-222680643 TTTTCACAGATGAGGCAACTTGG - Intronic
923881693 1:238110817-238110839 AGTACATGGATGAGGCCACATGG + Intergenic
1063227789 10:4032805-4032827 TGTCCACTGCAGGGGCCACAGGG - Intergenic
1064116190 10:12579333-12579355 TGTCCAGAGATAAGGCCACGGGG - Intronic
1065770788 10:29076279-29076301 GGATCACAGATAAGGCCACAGGG - Intergenic
1065887968 10:30095405-30095427 TGCCCATTGTTGAGGCCACAGGG - Intronic
1066317629 10:34264001-34264023 TGTGCACAGAAGAGCCCAAAGGG - Intronic
1067925996 10:50508314-50508336 TGTCCTCATAGTAGGCCACATGG + Intronic
1069887885 10:71635316-71635338 TGTCTACAGATGAAGGCACGAGG - Intronic
1070285952 10:75083940-75083962 TGTCCAGACAAGAGGCCAGAAGG - Intergenic
1072694073 10:97590247-97590269 CATCCACTGATGAGGCCACGTGG + Exonic
1073179330 10:101574471-101574493 TGTCCATGGAGGAGGCCGCAGGG - Intronic
1073610355 10:104937022-104937044 TTTCCACAGATGGGGGCACAGGG + Intronic
1074527163 10:114272731-114272753 TGTGCACAGAGGAGGGCGCACGG + Exonic
1075741513 10:124699045-124699067 AGGCCACTGAGGAGGCCACAGGG - Intronic
1075836446 10:125457374-125457396 TGTGCACAGCAGATGCCACAGGG + Intergenic
1076212618 10:128660568-128660590 TGGCCCCAGATGAGGGCACAGGG - Intergenic
1076219138 10:128719078-128719100 TGGCCACGGCTCAGGCCACACGG + Intergenic
1076354025 10:129839490-129839512 TGTCCACAGATGAGGCCACACGG - Intronic
1076614475 10:131746741-131746763 TGTCCACAGCTTTGGGCACACGG - Intergenic
1076647764 10:131965167-131965189 GATCCACAGAGGGGGCCACATGG + Intergenic
1076689200 10:132212492-132212514 TCACCTCAGCTGAGGCCACAGGG - Intronic
1077280848 11:1744782-1744804 TGTGAACAGATGAGGGAACAGGG + Intronic
1077735635 11:4787539-4787561 TGTCCACAGATTTTTCCACAAGG + Intronic
1079095226 11:17505668-17505690 GGCCAAGAGATGAGGCCACATGG - Intronic
1079246820 11:18758487-18758509 TGACCTCAGCTGATGCCACATGG + Intronic
1081360980 11:42177702-42177724 GGTCCACAATTGAGCCCACAAGG + Intergenic
1082259927 11:50071028-50071050 GGTCCACAGAGGTGGCCAAAAGG + Intergenic
1082958184 11:58894043-58894065 TTTCCATAGCAGAGGCCACAAGG - Intronic
1083007568 11:59362109-59362131 TGACCACTGATGAGTGCACAAGG - Intergenic
1083109215 11:60388536-60388558 TAGGCACAGATGAGGACACATGG - Intronic
1084101735 11:66954411-66954433 TGTCCACAGGTGAGACTAGAAGG + Exonic
1085031398 11:73272999-73273021 TGTCCACAGAGGAGGCCCTTGGG + Intronic
1086975922 11:93132747-93132769 TTTCCACAGATGAGGGCGGAGGG - Intergenic
1087077009 11:94134735-94134757 TCTCCACAAGTGCGGCCACAAGG + Intronic
1088848905 11:113689873-113689895 TGTGCCCAGATGGGGACACATGG - Exonic
1088978218 11:114834616-114834638 TGTCCACAGGTGAGGGTACTAGG + Intergenic
1090262284 11:125330311-125330333 AGTTCACAGACGAGGTCACATGG + Intronic
1090450297 11:126800285-126800307 AGTGCTCAGATGAGGACACAGGG - Intronic
1091126512 11:133104131-133104153 TGTCCACAGGTGAGAGCGCATGG + Intronic
1091358250 11:134954741-134954763 TGTCCACTACTGAGGCCCCATGG - Intergenic
1091657599 12:2356838-2356860 ATTCCACAGATGAGGCCGCTGGG + Intronic
1091906777 12:4195451-4195473 TTTCCACAGATGTGGCCATTAGG + Intergenic
1092293164 12:7177217-7177239 TGTGAATAGGTGAGGCCACATGG + Intergenic
1093523648 12:20079473-20079495 TAACCACAGAAGAGGCGACAGGG - Intergenic
1093567415 12:20624484-20624506 TGTCCACATAAGATACCACATGG + Intronic
1095775873 12:46009592-46009614 TGTCCAGATATTAGGCCAAATGG + Intergenic
1097233200 12:57524348-57524370 TGGGGACAGATGTGGCCACAGGG - Exonic
1097809437 12:64002396-64002418 TGTCCACATCTGAGGCCAAGTGG - Intronic
1097822640 12:64143549-64143571 TTTCCACAGAGGAGAACACAGGG - Exonic
1100231476 12:92612665-92612687 GGTCCACTGATGTGGCCACTAGG + Intergenic
1100466899 12:94854252-94854274 TGGACATAGAAGAGGCCACAGGG + Intergenic
1101523436 12:105505826-105505848 TGTCCACCACTGAGGCAACAGGG + Intergenic
1101842198 12:108335983-108336005 TGTCAGCAGTTGAGGCCAGAAGG - Intronic
1103613603 12:122138625-122138647 TGACCAGTGATGAGGCCACAGGG - Intronic
1104476223 12:129072734-129072756 TGTCCAAAGATGTGGCCTCGAGG - Exonic
1104628298 12:130377738-130377760 CTGCCACAGCTGAGGCCACAGGG - Intergenic
1105204304 13:18207334-18207356 TGTCCACAGTGGAGGCCAAAAGG + Intergenic
1107234156 13:38148453-38148475 TGTCTACAGAGCAGGCTACATGG - Intergenic
1111720790 13:91941543-91941565 AGTCCACCTAAGAGGCCACATGG - Intronic
1112588707 13:100744079-100744101 ATTCCACAGATGGGGCAACAGGG - Intergenic
1122022844 14:98853763-98853785 TGCCCACAGAGAAGCCCACATGG + Intergenic
1122645549 14:103190953-103190975 TGTCCACAGGGTAGGCCACGAGG + Intergenic
1123631083 15:22259638-22259660 TGTCCATAAATGAGCTCACACGG - Intergenic
1124376976 15:29134587-29134609 TGTCCATATATGACTCCACAGGG + Intronic
1128245578 15:66130468-66130490 TATCAAAAGATGAGGCCACCTGG + Intronic
1129713724 15:77834869-77834891 TGAGCACAGATGAGGACACCAGG + Intergenic
1131991590 15:98098109-98098131 TGTAGACAAATGAGGCCAGATGG - Intergenic
1132041070 15:98525000-98525022 TGGCCACCCAAGAGGCCACAGGG + Intergenic
1132099176 15:99011035-99011057 TGTAGACAAATGAGGCCAGATGG + Intergenic
1134195944 16:12159112-12159134 TGTCCTCAGTAGAGGGCACATGG - Intronic
1134492798 16:14708179-14708201 GAGCCACAGATGAGGCCATAGGG - Intergenic
1134498179 16:14747301-14747323 GAGCCACAGATGAGGCCATAGGG - Intronic
1135976330 16:27110818-27110840 TGCCCACAGCTGAGGTCACCAGG - Intergenic
1136288469 16:29257927-29257949 TGTCCACAGGAGAGGCCACGGGG - Intergenic
1138563665 16:57816860-57816882 TGGCCACAGATTTGGTCACAGGG - Intronic
1141019174 16:80478944-80478966 TCCCCACAAATGAGACCACAAGG + Intergenic
1141811881 16:86381398-86381420 TGCCCACTGCTGAGCCCACACGG + Intergenic
1141971931 16:87490867-87490889 TGTCCATAAATGAGCTCACACGG + Intronic
1142094183 16:88230833-88230855 TGTCCACAGGAGAGGCCACGGGG - Intergenic
1144741214 17:17583473-17583495 TTTCCACATAAGAGGCCACCTGG + Intronic
1146370533 17:32263303-32263325 TGTCCAAGGAAGAGGTCACAAGG - Intergenic
1147468572 17:40633936-40633958 TGACCACAGATGGGGACATAAGG + Intronic
1148516528 17:48223509-48223531 AGTTCACAGATGATGCCAAAAGG - Intronic
1149741589 17:59051477-59051499 AGTCCACAGATTATGACACAAGG + Intronic
1150252412 17:63714313-63714335 TGTCTACAAATGAGGAGACAAGG + Intronic
1150300902 17:64046108-64046130 GGTCGACAGCTGAGGACACAGGG + Intronic
1151702444 17:75750567-75750589 TTTGCACAGATGAGGCCCGAGGG - Intronic
1152118391 17:78403052-78403074 ATTCCACAGATGGGGTCACAGGG - Intronic
1152721014 17:81923847-81923869 TGGCCAGAGAGGAGGCTACAGGG + Intronic
1155315023 18:24562934-24562956 AGTCCAGAGAAGAGGACACAAGG + Intergenic
1155724915 18:29069481-29069503 TGTGCAAAGATGTTGCCACATGG - Intergenic
1156137966 18:34067986-34068008 CATCCAAAGATGAAGCCACAAGG + Intronic
1157815808 18:50728984-50729006 TGTCCCCAGCTGAGCCCCCAAGG + Intronic
1158406793 18:57166766-57166788 TGTGGAAATATGAGGCCACAGGG + Intergenic
1162524454 19:11199341-11199363 TGCACACAGATGGGGACACAGGG + Exonic
1166172740 19:41043127-41043149 TGTTCACAAATGAGAACACATGG + Intergenic
1166427604 19:42693369-42693391 TGTTTAGAGATGATGCCACATGG - Intronic
1166541425 19:43608240-43608262 TCCCCACAGATGAGTCCCCATGG + Intronic
1168362935 19:55757833-55757855 TTTCCACAACTGAGGCCACCTGG + Intergenic
1168363891 19:55767833-55767855 TTTCCACAACTGAGGCCACCTGG + Intergenic
1168710374 19:58496632-58496654 TGGCCCCAGGTGAGTCCACAAGG + Intronic
926679911 2:15655065-15655087 TGTTCACTCATGAGGACACAGGG - Intergenic
927022560 2:19032564-19032586 TGTCAACAGAGGAGGCCTCCTGG - Intergenic
927146033 2:20167359-20167381 TGTCCCCAGATGTCCCCACAGGG + Intergenic
927752065 2:25678052-25678074 TGACCTCAGTTGAAGCCACAGGG + Intergenic
927975327 2:27334214-27334236 TGTCCACAGAGGAGGTCTAAAGG - Intronic
929007125 2:37406708-37406730 TGTACATAGATGAGGAAACATGG + Intergenic
929589533 2:43136002-43136024 TACCTACAGAAGAGGCCACAGGG + Intergenic
930403834 2:50928753-50928775 TGTCCACAGGTAAGGCCGGATGG - Intronic
931241741 2:60460616-60460638 TGTCCACAGGAGAAGCCACACGG - Exonic
931382370 2:61765548-61765570 ACTCCACAGATAAAGCCACAGGG - Intergenic
931450398 2:62363356-62363378 GTTTCACAGATGAGGCAACAGGG - Intergenic
932119128 2:69082136-69082158 TGTATTCAGATCAGGCCACATGG - Intronic
932958301 2:76382253-76382275 TGTCTACAGATGAAGACACGGGG + Intergenic
934945450 2:98537938-98537960 TGTCCACAGACCGGGTCACAGGG - Exonic
935335321 2:102010215-102010237 TGTTCACTGTTGAAGCCACATGG + Intronic
938611586 2:132953167-132953189 TGGCCAGAGATGAGGCCAAGTGG - Intronic
939962633 2:148578939-148578961 TGTCCACAGACAAACCCACAGGG + Intergenic
941010045 2:160289042-160289064 TATCCACAGATGGGGACACTTGG - Intronic
941617165 2:167733789-167733811 TTTCCACAGATGAGGCTAACAGG + Intergenic
941927090 2:170906700-170906722 TGTGAACAGATGAGGCCAGGGGG + Intergenic
944515532 2:200509176-200509198 TGTTGACAGATGAGGCCATTGGG + Intronic
947617419 2:231567369-231567391 AGGCCACATGTGAGGCCACAGGG + Intergenic
947923461 2:233900079-233900101 TGTAGACATATGATGCCACAAGG + Intergenic
948675316 2:239593466-239593488 GGTCCATAGATGAGCACACAGGG + Intergenic
1169816475 20:9661953-9661975 TGTCCAGAGAAGAGCCCAGAGGG - Intronic
1170089220 20:12571994-12572016 TGTCCAGAGACTGGGCCACATGG + Intergenic
1173386705 20:42595117-42595139 TGTACCCAGATGAGACCCCAGGG + Intronic
1173538425 20:43833134-43833156 AGACCCCAGATGAGGCCCCAGGG + Intergenic
1174307082 20:49620898-49620920 TCTCCACAGATGATGACTCAGGG - Intergenic
1174885707 20:54331236-54331258 TTTCCACAGATGTTGCCAGAGGG + Intergenic
1175668686 20:60882520-60882542 TGTCCACAGATGGGCTCACTGGG + Intergenic
1175804999 20:61822530-61822552 TGTGCACAGAGGAGGCACCACGG - Intronic
1176248658 20:64109621-64109643 TGCCCAGAGCTCAGGCCACACGG - Intergenic
1176710475 21:10145922-10145944 TCTCTAGAGCTGAGGCCACATGG + Intergenic
1177039898 21:16095467-16095489 TGCTCACAGCTGAGGCCACTGGG + Intergenic
1177807019 21:25884468-25884490 TGTCAACAAATGAGGTCACCTGG + Intronic
1178604741 21:34025893-34025915 TATCCACAGATGTAGCAACAAGG + Intergenic
1181513404 22:23398804-23398826 TGTCGTCAGATGCGGCCCCAGGG - Intergenic
1181923653 22:26340581-26340603 TTTCCAAAGATGAGGCCAGCAGG - Exonic
1183299851 22:37053471-37053493 AGCCCACAGCAGAGGCCACAGGG - Intronic
1183618129 22:38957215-38957237 TGGCCACAGGGGAGGACACAGGG + Intronic
1183826036 22:40388470-40388492 TGTTCAGAGATGAGGCTGCAGGG + Intronic
1184073898 22:42163926-42163948 AGGCCACGGATGAGGCCAAAGGG - Intronic
1184849352 22:47111100-47111122 ACTCCACAGATGAGGAAACAAGG - Intronic
1184955214 22:47881351-47881373 TGTGCACAGATGTGGGCAGAGGG - Intergenic
1185088280 22:48752461-48752483 TGCCCACACCTGAGGCCACCTGG + Intronic
1185360730 22:50405198-50405220 TGGCCACAGATGTGGCCTCGCGG + Intronic
953705607 3:45227595-45227617 TGTCCCCAGATGTTCCCACATGG + Intergenic
953912616 3:46900541-46900563 TGTCCCAAGCAGAGGCCACAGGG - Intronic
954171545 3:48807194-48807216 AGTCCACAGATTAGGCTACTGGG - Intronic
954995945 3:54881834-54881856 CGCCCTCAGATGATGCCACAGGG + Intronic
955389743 3:58512633-58512655 AGAACACAGAAGAGGCCACAGGG - Intronic
955478342 3:59362735-59362757 TGTCCACAGAATACCCCACATGG + Intergenic
955760828 3:62280292-62280314 TCTTTACAGATGAGGACACAAGG - Intronic
957464425 3:80568676-80568698 TGTTGACAGATGAGGCAACAAGG + Intergenic
959939182 3:112062539-112062561 TGCCCACTGAAGAGTCCACAGGG + Intronic
961934037 3:130564272-130564294 TGGCCACAGATCAGAACACAGGG - Intronic
962733803 3:138306342-138306364 TATCCACAAAAGAGGACACAAGG + Intronic
965631224 3:170734823-170734845 GGTTCAGGGATGAGGCCACAGGG - Intronic
968565861 4:1312373-1312395 TGTCCAGAGTCCAGGCCACAGGG + Intronic
969469040 4:7375783-7375805 TGTCCACAGAGGAGTGGACAAGG + Intronic
970091049 4:12408538-12408560 CATCCACAGATGAGGGAACAAGG - Intergenic
971736796 4:30463936-30463958 TTTCCACAAATGGGGCCACTGGG - Intergenic
972245769 4:37244499-37244521 TGTCCACAGAGGAGTCCAGGAGG + Exonic
973829726 4:54746588-54746610 TGTCCACACAACAGGCCACCTGG + Intergenic
975741840 4:77436793-77436815 TTTCCACATATGAGATCACATGG + Intergenic
978778810 4:112528617-112528639 TCTGCACTGATGAGGCCACAGGG - Intergenic
978945019 4:114485132-114485154 TGTCCACAGATGGAGACACCAGG + Intergenic
979767641 4:124481631-124481653 AGTACAGAGATCAGGCCACAGGG - Intergenic
981583454 4:146273828-146273850 TGTAAACAGATGAGGCCAGTGGG - Intronic
984841320 4:184070287-184070309 TGGCCTCAGAGGAGGCCTCAGGG - Intergenic
986062724 5:4207150-4207172 TGTCCAGAGAGGAACCCACAGGG - Intergenic
986563934 5:9091705-9091727 TGTCCACTGAGGAGCCCTCATGG - Intronic
989565676 5:42898876-42898898 TCTCCACAGCAGAGGCCTCAAGG + Intergenic
990491331 5:56305811-56305833 TGTCCACAGATGTAGCAGCAGGG + Intergenic
990574995 5:57115705-57115727 TGTCCACAGATCAGAACCCAAGG + Intergenic
992921910 5:81533637-81533659 AGTGAACAGATGAGGTCACAAGG + Intronic
994509364 5:100684341-100684363 TGTCCAGAGCCTAGGCCACATGG - Intergenic
994650394 5:102519918-102519940 TATTCACAGTTGTGGCCACAAGG + Intergenic
995409652 5:111841555-111841577 TGTCTACAGATGAGACTAGAAGG + Intronic
1000844345 5:166260683-166260705 AGTTCACAGATCAAGCCACAGGG + Intergenic
1001334132 5:170783747-170783769 TGTCCACATACGAGGGGACAGGG + Exonic
1002110384 5:176905639-176905661 TTTTCACAGATGAGGTCACTGGG + Intronic
1002293424 5:178214834-178214856 TGATCAAAGATGAGGCCACAAGG - Exonic
1002392458 5:178926466-178926488 TGTACAGAGGTGAGGCAACAGGG + Intronic
1002921569 6:1576879-1576901 GCCCCACAGATGATGCCACACGG - Intergenic
1002951008 6:1810914-1810936 TTTCCACAGAAAATGCCACAAGG - Intronic
1005588015 6:27295936-27295958 TGTCCTCAGACAAGACCACAAGG + Intronic
1005910738 6:30307347-30307369 TGTCCACAGATAACACCTCAAGG + Intergenic
1006379385 6:33688773-33688795 CGTCCACAGGTGAGAACACAGGG + Exonic
1006716185 6:36122235-36122257 TGTCCAGGGCAGAGGCCACAGGG - Intergenic
1009695152 6:67093429-67093451 TTTCCACAAATGAAGCCAGAGGG + Intergenic
1014461045 6:121695896-121695918 TGTATACAGATGTGGCCATATGG + Intergenic
1014686766 6:124511434-124511456 TGCCCACACATGAGAGCACAAGG + Intronic
1015592548 6:134836258-134836280 TGTCACCAGAGCAGGCCACAGGG - Intergenic
1017178604 6:151528204-151528226 TGTCCTCAGGTGAGGACAAATGG + Intronic
1017407263 6:154133887-154133909 TTTCCACAGAAAAGGCCAAAGGG + Intronic
1018171100 6:161143607-161143629 TGTCCACAGAAGATCACACAAGG + Intronic
1018253908 6:161899237-161899259 TGTCCAAAAATAAGGCCAGACGG + Intronic
1018289940 6:162281862-162281884 TTTCCACAGATGAGGGCAATGGG + Intronic
1018381169 6:163259757-163259779 GGGCCACAGATGGGGCAACATGG - Intronic
1019048785 6:169167772-169167794 TGTCAGCAGATGAGGCCACGGGG + Intergenic
1019419743 7:945519-945541 TGCCCCCAGAACAGGCCACAAGG + Intronic
1022503640 7:30897438-30897460 TCCCCACAGAGCAGGCCACAGGG - Intergenic
1022719704 7:32931805-32931827 TGTCCACAGATGAAGCCAAAGGG - Intergenic
1023948790 7:44824612-44824634 TGTCCTCAGATGCAGACACAAGG + Intergenic
1024269697 7:47633017-47633039 ACTCCACGGATGAGGACACAAGG + Intergenic
1027182121 7:75948180-75948202 GAGCTACAGATGAGGCCACACGG - Intronic
1032505917 7:132434679-132434701 TGTCCCCAAATGAGGCAAGATGG - Intronic
1033154570 7:138945938-138945960 TGTCCACAATTGAGGCCAACAGG + Intronic
1034860505 7:154591122-154591144 GGTGCAAAGACGAGGCCACAAGG + Intronic
1039775572 8:40732749-40732771 TTCCCACAGTTGAGGCCACTGGG - Intronic
1040062422 8:43115295-43115317 TCTGCACAGATGAAGCCAGAAGG - Intronic
1040392689 8:46963032-46963054 TGGCCACAGAAGAGACCCCATGG - Intergenic
1041327268 8:56681711-56681733 TGCCCAGAGATGATGCCACGAGG - Intergenic
1041411834 8:57564825-57564847 AGCCCACAGATGAGGCCAGAGGG - Intergenic
1043291716 8:78610341-78610363 TATACAAAGAGGAGGCCACAGGG + Intergenic
1048192283 8:132300811-132300833 ACTCTACAGATGAGCCCACAAGG - Intronic
1049443133 8:142618221-142618243 TGGTGACAGATGAGGCCACAAGG - Intergenic
1052518666 9:29514651-29514673 TCCCCACAGATGCTGCCACAGGG - Intergenic
1055318094 9:75054215-75054237 TTTTCACAGATGAGGCAAAAAGG + Intergenic
1055633783 9:78253465-78253487 TCTACACAGATGAAACCACAAGG - Intronic
1056109521 9:83381039-83381061 TTTCCCCAGAAGAGGCCAGAGGG - Intronic
1060501985 9:124165177-124165199 GGTCACCAGATGAGTCCACATGG + Intergenic
1061221678 9:129255650-129255672 TCTGCAGAGATGGGGCCACATGG + Intergenic
1062472079 9:136710522-136710544 TTTCAACAGATGATGCCAGAAGG + Intergenic
1062683608 9:137798607-137798629 TGACCACTCATGGGGCCACAGGG + Intronic
1202795238 9_KI270719v1_random:114917-114939 TCTCTAGAGCTGAGGCCACATGG + Intergenic
1187494445 X:19782435-19782457 TGTCCACCAATGAGGCCTCTGGG + Intronic
1187505511 X:19875407-19875429 AGAGCACAGAAGAGGCCACACGG + Intronic
1189529612 X:41866077-41866099 TGTCTACAGAGCAGACCACAGGG + Intronic
1189944767 X:46166871-46166893 TGTCATCAGAAGAGGCTACAAGG - Intergenic
1192156312 X:68749168-68749190 TTTCCACAGATGAGGCCTGGAGG - Intergenic
1199684991 X:150257790-150257812 ATTCCACAGATGAGGAAACAGGG - Intergenic
1199727583 X:150599758-150599780 TGTACATGGATCAGGCCACAGGG + Intronic